ZFIN ID: ZDB-MRPHLNO-151012-1
Morpholino Name: MO1-pck1
Target: pck1 (1)
Sequence:
5' - CCTTGAGTGAAGGTTTAGCAGCTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO, targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pck1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pck1
Expressed Gene Anatomy Figures
pck1 text only from Furukawa et al., 2015
PHENOTYPE
Phenotype resulting from MO1-pck1
Phenotype Figures
energy coupled proton transmembrane transport, against electrochemical gradient decreased process quality, abnormal text only from Furukawa et al., 2015
glucose homeostasis process quality, abnormal text only from Furukawa et al., 2015
whole organism pck1 expression absent, abnormal text only from Furukawa et al., 2015
whole organism ab3-atp6v1a labeling decreased amount, abnormal text only from Furukawa et al., 2015

Phenotype of all Fish created by or utilizing MO1-pck1
Phenotype Fish Conditions Figures
vH ionocyte increased amount, abnormal AB + MO1-pck1 acidic text only from Furukawa et al., 2015
glutamate homeostasis process quality, abnormal AB + MO1-pck1 acidic text only from Furukawa et al., 2015
energy coupled proton transmembrane transport, against electrochemical gradient decreased process quality, abnormal AB + MO1-pck1 standard conditions text only from Furukawa et al., 2015
whole organism ab3-atp6v1a labeling decreased amount, abnormal AB + MO1-pck1 acidic, chemical treatment: estrogen receptor agonist text only from Furukawa et al., 2015
whole organism pck1 expression decreased amount, abnormal AB + MO1-pck1 acidic text only from Furukawa et al., 2015
vH ionocyte increased amount, abnormal AB + MO1-pck1 acidic, chemical treatment: estrogen receptor agonist text only from Furukawa et al., 2015
whole organism pck1 expression absent, abnormal AB + MO1-pck1 standard conditions text only from Furukawa et al., 2015
energy coupled proton transmembrane transport, against electrochemical gradient process quality, ameliorated AB + MO1-pck1 acidic, chemical treatment: estrogen receptor agonist text only from Furukawa et al., 2015
energy coupled proton transmembrane transport, against electrochemical gradient decreased process quality, abnormal AB + MO1-pck1 acidic text only from Furukawa et al., 2015
glucose homeostasis process quality, abnormal AB + MO1-pck1 acidic text only from Furukawa et al., 2015
glucose homeostasis process quality, abnormal AB + MO1-pck1 standard conditions text only from Furukawa et al., 2015
whole organism ab3-atp6v1a labeling decreased amount, abnormal AB + MO1-pck1 acidic text only from Furukawa et al., 2015
whole organism ab3-atp6v1a labeling decreased amount, abnormal AB + MO1-pck1 standard conditions text only from Furukawa et al., 2015
OTHER MO1-pck1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)