ZFIN ID: ZDB-MRPHLNO-150826-2
Morpholino Name: MO3-dhx37
Target: dhx37 (1)
Sequence:
5' - TGTGTTTCTTTCTCAATCTGCCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-dhx37 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-dhx37 No data available
PHENOTYPE
Phenotype resulting from MO3-dhx37
Phenotype Figures
brain anterior region decreased size, abnormal Fig. 7 with image from Quach et al., 2015
pericardium edematous, abnormal Fig. 7 with image from Quach et al., 2015
whole organism anterior-posterior axis decreased length, abnormal Fig. 7 with image from Quach et al., 2015

Phenotype of all Fish created by or utilizing MO3-dhx37
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO3-dhx37 standard conditions Fig. 7 with image from Quach et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-dhx37 standard conditions Fig. 7 with image from Quach et al., 2015
brain anterior region decreased size, abnormal WT + MO3-dhx37 standard conditions Fig. 7 with image from Quach et al., 2015
OTHER MO3-dhx37 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)