ZFIN ID: ZDB-MRPHLNO-150618-2
Morpholino Name: MO1-gpr143
Target: gpr143 (1)
Previous Name: gpr143 atg1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGGCCATGATGATGAAGATGAAGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gpr143 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gpr143 No data available
PHENOTYPE
Phenotype resulting from MO1-gpr143
Phenotype Figures
retinal pigmented epithelium decreased pigmentation, abnormal Fig. 1 with image from Burgoyne et al., 2015
retinal pigmented epithelium melanosome decreased amount, abnormal Fig. 1 with image from Burgoyne et al., 2015

Phenotype of all Fish created by or utilizing MO1-gpr143
Phenotype Fish Conditions Figures
retinal pigmented epithelium melanosome decreased amount, abnormal WT + MO1-gpr143 standard conditions Fig. 1 with image from Burgoyne et al., 2015
retinal pigmented epithelium decreased pigmentation, abnormal WT + MO1-gpr143 standard conditions Fig. 1 with image from Burgoyne et al., 2015
OTHER MO1-gpr143 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)