ZFIN ID: ZDB-MRPHLNO-150611-3
Morpholino Name: MO1-mycb
Target: mycb (1)
Sequence:
5' - GTGGTAAAAGCTGAATGAACACTGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mycb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mycb
Expressed Gene Anatomy Figures
myb Fig. 4 with image from Lin et al., 2015
PHENOTYPE
Phenotype resulting from MO1-mycb
Phenotype Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal Fig. 4 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal Fig. 4 with image from Lin et al., 2015

Phenotype of all Fish created by or utilizing MO1-mycb
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal WT + MO1-mycb control Fig. 4 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-mycb control Fig. 4 with image from Lin et al., 2015
OTHER MO1-mycb MORPHOLINO PAGESNo links to external sites
CITATIONS (1)