header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150519-3
Morpholino Name: MO1-impdh2
Target: impdh2 (1)
Sequence:
5' - GCTGATTAAATAGTCCGCCATAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-impdh2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-impdh2
Expressed Gene Anatomy Figures
bcat1 Fig. S6 with image from Li et al., 2015
dhfr Fig. S6 with image from Li et al., 2015
psat1 Fig. S6 with image from Li et al., 2015
rpe65a Fig. S6 with image from Li et al., 2015
PHENOTYPE
Phenotype resulting from MO1-impdh2
Phenotype of all Fish created by or utilizing MO1-impdh2
OTHER MO1-impdh2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)