ZFIN ID: ZDB-MRPHLNO-140224-9
Morpholino Name: MO2-nfe2
Target: nfe2 (1)
Sequence:
5' - AACGATGTGTCCGTAATCCAGTGAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-nfe2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-nfe2 No data available
PHENOTYPE
Phenotype resulting from MO2-nfe2
Phenotype Figures
esophageal epithelium mucus secreting cell decreased amount, abnormal Fig. 5 with image from Williams et al., 2013
esophagus muscle decreased size, abnormal Fig. 5 with image from Williams et al., 2013
gill morphology, abnormal Fig. 5 with image from Williams et al., 2013
pharyngeal arch morphology, abnormal Fig. 5 with image from Williams et al., 2013
pneumatic duct epithelial cell decreased amount, abnormal Fig. 5 with image from Williams et al., 2013
pneumatic duct epithelial cell disoriented, abnormal Fig. 5 with image from Williams et al., 2013
pneumatic duct epithelial cell increased variability of size, abnormal Fig. 5 with image from Williams et al., 2013
pneumatic duct epithelium morphology, abnormal Fig. 5 with image from Williams et al., 2013
swim bladder uninflated, abnormal Fig. 5 with image from Williams et al., 2013

Phenotype of all Fish created by or utilizing MO2-nfe2
Phenotype Fish Conditions Figures
pneumatic duct epithelial cell increased variability of size, abnormal WT + MO2-nfe2 standard conditions Fig. 5 with image from Williams et al., 2013
gill morphology, abnormal WT + MO2-nfe2 standard conditions Fig. 5 with image from Williams et al., 2013
pneumatic duct epithelium morphology, abnormal WT + MO2-nfe2 standard conditions Fig. 5 with image from Williams et al., 2013
pneumatic duct epithelial cell disoriented, abnormal WT + MO2-nfe2 standard conditions Fig. 5 with image from Williams et al., 2013
esophagus muscle decreased size, abnormal WT + MO2-nfe2 standard conditions Fig. 5 with image from Williams et al., 2013
swim bladder uninflated, abnormal WT + MO2-nfe2 standard conditions Fig. 5 with image from Williams et al., 2013
pharyngeal arch morphology, abnormal WT + MO2-nfe2 standard conditions Fig. 5 with image from Williams et al., 2013
esophageal epithelium mucus secreting cell decreased amount, abnormal WT + MO2-nfe2 standard conditions Fig. 5 with image from Williams et al., 2013
pneumatic duct epithelial cell decreased amount, abnormal WT + MO2-nfe2 standard conditions Fig. 5 with image from Williams et al., 2013
OTHER MO2-nfe2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)