ZFIN ID: ZDB-MRPHLNO-131119-9
Morpholino Name: MO2-dkk2
Target: dkk2 (1)
Sequence:
5' - GTGAATGAATGAGGTTTACCTGAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-dkk2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-dkk2 No data available
PHENOTYPE
Phenotype resulting from MO2-dkk2
Phenotype Figures
neuromast has extra parts of type neuromast hair cell, abnormal Fig. 2 with image from Wada et al., 2013
neuromast increased area, abnormal Fig. 2 with image from Wada et al., 2013
neuromast increased size, abnormal Fig. 2 with image from Wada et al., 2013

Phenotype of all Fish created by or utilizing MO2-dkk2
Phenotype Fish Conditions Figures
neuromast has extra parts of type neuromast hair cell, abnormal WT + MO2-dkk2 standard conditions Fig. 2 with image from Wada et al., 2013
neuromast increased area, abnormal zf106Tg + MO2-dkk2 standard conditions Fig. 2 with image from Wada et al., 2013
neuromast has extra parts of type neuromast hair cell, abnormal zf106Tg + MO2-dkk2 standard conditions Fig. 2 with image from Wada et al., 2013
neuromast increased size, abnormal zf106Tg + MO2-dkk2 standard conditions Fig. 2 with image from Wada et al., 2013
OTHER MO2-dkk2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)