ZFIN ID: ZDB-MRPHLNO-131112-3
Morpholino Name: MO1-lypd6
Target: lypd6 (1)
Sequence:
5' - CCATGAGAGGCCAGGGCTCCATAAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lypd6 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lypd6
Expressed Gene Anatomy Figures
gsc Fig. 3 with image from Özhan et al., 2013
hoxb1b Fig. 3 with image from Özhan et al., 2013
otx2b Fig. 3 with image from Özhan et al., 2013
PHENOTYPE
Phenotype resulting from MO1-lypd6
Phenotype of all Fish created by or utilizing MO1-lypd6
Genome Resources:
CITATIONS (1)