header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-131002-1
Morpholino Name: MO4-cyp26a1
Target: cyp26a1 (1)
Sequence:
5' - TCTTATCATCCTTACCTTTTTCTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-cyp26a1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-cyp26a1 No data available
PHENOTYPE
Phenotype resulting from MO4-cyp26a1
No data available

Phenotype of all Fish created by or utilizing MO4-cyp26a1
Phenotype Fish Conditions Figures
heart edematous, abnormal WT + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
hindbrain edematous, abnormal WT + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
whole organism mmp9 expression increased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 5 with image from Rydeen et al., 2016
whole organism fgf8a expression decreased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 4 with image from Rydeen et al., 2016
heart fgf8a expression decreased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 4 with image from Rydeen et al., 2016
heart mmp9 expression increased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 5 with image from Rydeen et al., 2016
hindbrain edematous, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
atrium has fewer parts of type cardiac muscle cell, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 2 with image from Rydeen et al., 2014
heart edematous, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
midbrain hindbrain boundary absent, abnormal WT + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with imageFig. 6 with image from D'Aniello et al., 2013
caudal fin shortened, abnormal WT + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with image from D'Aniello et al., 2013
ventricular myocardium cardiac muscle cell mislocalised, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 5 with image from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
whole organism myl7 expression decreased amount, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 1 with imageFig. 5 with image from Rydeen et al., 2016
cardiac ventricle decreased size, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis process quality, ameliorated f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
whole organism myh7 expression decreased amount, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with image from D'Aniello et al., 2013
heart has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with image from D'Aniello et al., 2013
cell migration involved in heart formation process quality, abnormal fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 2 with image from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch has extra parts of type blood vessel endothelial cell, abnormal fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac muscle cell mislocalised, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with imageFig. 5 with image from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac muscle cell circular, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium cell-cell junction ab1-ctnnb labeling spatial pattern, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium bicellular tight junction ab1-tjp1 labeling spatial pattern, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle establishment of cell polarity decreased process quality, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
endocardium has fewer parts of type endothelial cell, abnormal ubs1Tg + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 7 with image from Rydeen et al., 2014
cranial vasculature has fewer parts of type endothelial cell, abnormal ubs1Tg + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 7 with image from Rydeen et al., 2014
ventricular myocardium cardiac muscle cell mislocalised, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
aortic arch 4 has extra parts of type blood vessel endothelial cell, abnormal fb9Tg ; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal fb9Tg ; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch 3 has extra parts of type blood vessel endothelial cell, abnormal fb9Tg ; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated sd22Tg ; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
ventricular myocardium increased distance ventricular endocardium, abnormal twu34Tg ; ci5Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal twu34Tg ; ci5Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
OTHER MO4-cyp26a1 MORPHOLINO PAGESNo links to external sites
CITATIONS (5)