header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130910-8
Morpholino Name: MO2-mtmr12
Target: mtmr12 (1)
Previous Name: exon3-intron3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCCCGGTCAACTGTCCTTACCATCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-mtmr12 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-mtmr12 No data available
PHENOTYPE
Phenotype resulting from MO2-mtmr12
Phenotype of all Fish created by or utilizing MO2-mtmr12
Phenotype Fish Conditions Figures
whole organism decreased mobility, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with imageFig. SMovie S1 from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal AB + MO2-mtmr12 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal AB + MO2-mtmr12 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle T-tubule disorganized, abnormal AB + MO2-mtmr12 standard conditions Fig. 4 with imageFig. 7 with image from Gupta et al., 2013
trunk curved dorsal, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with image from Gupta et al., 2013
whole organism decreased length, abnormal AB + MO2-mtmr12 standard conditions Fig. 7 with image from Gupta et al., 2013
thigmotaxis disrupted, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with image from Gupta et al., 2013
locomotory behavior disrupted, abnormal AB + MO2-mtmr12 standard conditions Fig. SMovie S1 from Gupta et al., 2013
muscle cell nucleus displaced to muscle cell central region, abnormal AB + MO2-mtmr12 standard conditions Fig. 3 with image from Gupta et al., 2013
hatching decreased occurrence, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with image from Gupta et al., 2013
pericardium edematous, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with image from Gupta et al., 2013
skeletal muscle refractivity, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with imageFig. 7 with image from Gupta et al., 2013
skeletal muscle T-tubule absent, abnormal AB + MO2-mtmr12 standard conditions Fig. 4 with image from Gupta et al., 2013
skeletal muscle refractivity, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 2 with imageFig. 7 with image from Gupta et al., 2013
muscle cell nucleus displaced to muscle cell central region, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle non-functional, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 4 with image from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle Z disc absent, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 4 with image from Gupta et al., 2013
thigmotaxis disrupted, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. SMovie S1 from Gupta et al., 2013
whole organism decreased length, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 7 with image from Gupta et al., 2013
skeletal muscle T-tubule disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 7 with image from Gupta et al., 2013
whole organism decreased size, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 2 with image from Gupta et al., 2013
OTHER MO2-mtmr12 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)