header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130806-1
Morpholino Name: MO1-mir21-2
Target: mir21-2 (1)
Previous Names: dremir-21-2 MO (1), multi-blocker (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACTCAAAGCCAACACCAGTCTGATAAGCTAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a multi-blocker morpholino that targets both Drosha and Dicer processing sites in pre-mir21-2.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mir21-2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mir21-2
Expressed Gene Anatomy Figures
bmp4 Fig. 2 with image from Kolpa et al., 2013
has2 Fig. 2 with image from Kolpa et al., 2013
notch1b Fig. 2 with image from Kolpa et al., 2013
nppa Fig. 2 with image from Kolpa et al., 2013
pdcd4b Fig. S4 with image from Kolpa et al., 2013
spp1 Fig. 2 with image from Kolpa et al., 2013
tbx2b Fig. 2 with image from Kolpa et al., 2013
vcana Fig. 2 with image from Kolpa et al., 2013
PHENOTYPE
Phenotype resulting from MO1-mir21-2
Phenotype of all Fish created by or utilizing MO1-mir21-2
Phenotype Fish Conditions Figures
atrioventricular valve development disrupted, abnormal AB + MO1-mir21-2 + MO3-mir21-2 standard conditions Fig. 1 with image from Wu et al., 2017
whole organism pcbp2 expression decreased amount, abnormal AB + MO1-mir21-2 + MO3-mir21-2 standard conditions Fig. 5 from Wu et al., 2017
whole organism tpm1 expression decreased amount, abnormal AB + MO1-mir21-2 + MO3-mir21-2 standard conditions Fig. 5 from Wu et al., 2017
whole organism nanog expression decreased amount, abnormal AB + MO1-mir21-2 + MO3-mir21-2 standard conditions Fig. 5 from Wu et al., 2017
whole organism Ab1-kat7 labeling decreased amount, abnormal AB + MO1-mir21-2 + MO3-mir21-2 standard conditions Fig. 5 from Wu et al., 2017
atrioventricular ring immature, abnormal TL + MO1-mir21-2 standard conditions Fig. 1 with image from Kolpa et al., 2013
atrioventricular valve development arrested, abnormal TL + MO1-mir21-2 standard conditions Fig. 1 with image from Kolpa et al., 2013
heart looping disrupted, abnormal TL + MO1-mir21-2 standard conditions Fig. 1 with image from Kolpa et al., 2013
pericardium edematous, abnormal TL + MO1-mir21-2 standard conditions Fig. 1 with image from Kolpa et al., 2013
heart decreased width, abnormal WT + MO1-mir21-1 + MO1-mir21-2 standard conditions Fig. 4 from Banjo et al., 2013
atrioventricular canal has fewer parts of type endocardium cell, abnormal WT + MO1-mir21-1 + MO1-mir21-2 standard conditions Fig. S3 from Banjo et al., 2013
blood cell accumulation yolk anatomical surface, abnormal WT + MO1-mir21-1 + MO1-mir21-2 standard conditions Fig. 4 from Banjo et al., 2013
heart looping arrested, abnormal WT + MO1-mir21-1 + MO1-mir21-2 standard conditions Fig. 4 from Banjo et al., 2013
hindbrain hypoplastic, abnormal WT + MO1-mir21-1 + MO1-mir21-2 standard conditions Fig. 4 from Banjo et al., 2013
blood circulation decreased process quality, abnormal WT + MO1-mir21-1 + MO1-mir21-2 standard conditions Fig. 4 from Banjo et al., 2013
endocardial cushion aplastic, abnormal y1Tg + MO1-mir21-1 + MO1-mir21-2 standard conditions Fig. 4Fig. 6 from Banjo et al., 2013
atrioventricular canal cell population proliferation decreased process quality, abnormal y1Tg + MO1-mir21-1 + MO1-mir21-2 standard conditions Fig. S5 from Banjo et al., 2013
heart valve development disrupted, abnormal y1Tg + MO1-mir21-1 + MO1-mir21-2 standard conditions Fig. 4Fig. 6 from Banjo et al., 2013
Genome Resources:
CITATIONS (3)