ZFIN ID: ZDB-MRPHLNO-130401-4
Morpholino Name: MO1-lhx4
Target: lhx4 (1)
Sequence:
5' - GCAGCACAGCCGCACTTTGCATCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lhx4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lhx4
Expressed Gene Anatomy Figures
syt2b Fig. 3 with image from Seredick et al., 2014
PHENOTYPE
Phenotype resulting from MO1-lhx4
No data available

Phenotype of all Fish created by or utilizing MO1-lhx4
Phenotype Fish Conditions Figures
primary motor neuron spinal cord motor neuron cell fate specification decreased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 5 with image from Seredick et al., 2014
secondary motor neuron axon extension decreased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
Kolmer-Agduhr neuron ventral spinal cord interneuron specification increased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 5 with image from Seredick et al., 2014
primary motor neuron axon morphology, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
ventral spinal nerve has fewer parts of type CaP motoneuron axon, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
secondary motor neuron axon morphology, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
primary motor neuron axon extension decreased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
primary motor neuron ventral spinal cord interneuron specification increased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 5 with image from Seredick et al., 2014
ventral spinal nerve has fewer parts of type secondary motor neuron axon, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
ventral spinal nerve decreased diameter, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
swimming decreased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions text only from Seredick et al., 2014
spinal cord has fewer parts of type primary motor neuron, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 5 with image from Seredick et al., 2014
spinal cord has fewer parts of type CiD, abnormal nns1Tg + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 7 with image from Seredick et al., 2014
ventral spinal cord interneuron differentiation decreased occurrence, abnormal nns1Tg + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 7 with image from Seredick et al., 2014
ventral spinal cord interneuron differentiation decreased occurrence, abnormal nns5Tg + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 7 with image from Seredick et al., 2014
spinal cord has fewer parts of type VeLD, abnormal nns5Tg + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 7 with image from Seredick et al., 2014
Genome Resources:
CITATIONS (2)