ZFIN ID: ZDB-MRPHLNO-130401-2
Morpholino Name: MO1-mnx2b
Target: mnx2b (1)
Sequence:
5' - GACTTTTCCATTGCAACACTTTTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mnx2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mnx2b
Expressed Gene Anatomy Figures
isl1 Fig. 5 with image from Wendik et al., 2004
mnx1 Fig. 5 with image from Wendik et al., 2004
pdx1 Fig. 5 with image from Wendik et al., 2004
PHENOTYPE
Phenotype resulting from MO1-mnx2b
No data available

Phenotype of all Fish created by or utilizing MO1-mnx2b
Genome Resources:
CITATIONS (4)