header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130401-1
Morpholino Name: MO5-mnx1
Target: mnx1 (1)
Sequence:
5' - ACCTCACAAACAGATTAACGCCTCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-mnx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-mnx1
Expressed Gene Anatomy Figures
ins Fig. 6 with image from Wendik et al., 2004
isl1 Fig. 5 with image from Wendik et al., 2004
mnx1 Fig. 5 with image from Wendik et al., 2004
mnx2a Fig. 6 with image from Wendik et al., 2004
pdx1 Fig. 5 with image from Wendik et al., 2004
prss1 Fig. 6 with image from Wendik et al., 2004
PHENOTYPE
Phenotype resulting from MO5-mnx1
Phenotype of all Fish created by or utilizing MO5-mnx1
Genome Resources:
CITATIONS (3)