ZFIN ID: ZDB-MRPHLNO-130205-2
Morpholino Name: MO2-aldh8a1
Target: aldh8a1 (1)
Sequence:
5' - GATATTTCATGTCTTTTGACATCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-aldh8a1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-aldh8a1
Expressed Gene Anatomy Figures
fabp10a Fig. 2 with image from Garnaas et al., 2012
prox1a Fig. 2 with image from Garnaas et al., 2012
PHENOTYPE
Phenotype resulting from MO2-aldh8a1
Phenotype of all Fish created by or utilizing MO2-aldh8a1
Genome Resources:
CITATIONS (1)