header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120911-6
Morpholino Name: MO1-arxa
Target: arxa (1)
Previous Names: MO1-arx, arxE2I2-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TACTATGCGTCATATTTACCTGGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-arxa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-arxa No data available
PHENOTYPE
Phenotype resulting from MO1-arxa
Phenotype of all Fish created by or utilizing MO1-arxa
Genome Resources:
CITATIONS (1)