header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120606-3
Morpholino Name: MO1-ppp4cb
Target: ppp4cb (1)
Sequence:
5' - AGCCCGTCTGCCTGTTTTCCCCTCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO, targets the 5' UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ppp4cb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ppp4cb
Expressed Gene Anatomy Figures
chrd Fig. 1 with image from Jia et al., 2012
eve1 Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 7 with image from Jia et al., 2012
foxi1 Fig. 3 with image from Jia et al., 2012
gata2a Fig. 1 with imageFig. 2 with imageFig. 3 with image from Jia et al., 2012
gsc Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 7 with image from Jia et al., 2012
PHENOTYPE
Phenotype resulting from MO1-ppp4cb
Phenotype of all Fish created by or utilizing MO1-ppp4cb
OTHER MO1-ppp4cb MORPHOLINO PAGESNo links to external sites
CITATIONS (1)