ZFIN ID: ZDB-MRPHLNO-120604-2
Morpholino Name: MO4-ntn1a
Target: ntn1a (1)
Sequence:
5' - CCAAAGCATCAGAGACTCTCAACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-ntn1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-ntn1a No data available
PHENOTYPE 
Phenotype resulting from MO4-ntn1a
Phenotype Figures
anterior commissure axon extension process quality, abnormal Fig. 7 from Zhang et al., 2012
anterior commissure morphogenesis process quality, abnormal Fig. 7 from Zhang et al., 2012
blood vessel endothelial cell migration decreased process quality, abnormal Fig. S6 from Tu et al., 2015
blood vessel endothelial cell proliferation involved in sprouting angiogenesis decreased process quality, abnormal Fig. S6 from Tu et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal Fig. 6 with image from Tu et al., 2015
vasculature development disrupted, abnormal Fig. 6 with image from Tu et al., 2015
whole organism lacks all parts of type parachordal vessel, abnormal Fig. 6 with image from Tu et al., 2015

Phenotype of all Fish created by or utilizing MO4-ntn1a
Phenotype Fish Conditions Figures
anterior commissure axon extension process quality, abnormal b1204Tg + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
vasculature development disrupted, abnormal la116Tg + MO4-ntn1a standard conditions Fig. 6 with image from Tu et al., 2015
whole organism lacks all parts of type parachordal vessel, abnormal la116Tg + MO4-ntn1a standard conditions Fig. 6 with image from Tu et al., 2015
blood vessel endothelial cell migration decreased process quality, abnormal is5Tg; y7Tg + MO4-ntn1a standard conditions Fig. S6 from Tu et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal is5Tg; y7Tg + MO4-ntn1a standard conditions Fig. 6 with image from Tu et al., 2015
blood vessel endothelial cell proliferation involved in sprouting angiogenesis decreased process quality, abnormal is5Tg; y7Tg + MO4-ntn1a standard conditions Fig. S6 from Tu et al., 2015
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
OTHER MO4-ntn1a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)