header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120604-2
Morpholino Name: MO4-ntn1a
Target: ntn1a (1)
Sequence:
5' - CCAAAGCATCAGAGACTCTCAACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-ntn1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-ntn1a No data available
PHENOTYPE
Phenotype resulting from MO4-ntn1a
Phenotype of all Fish created by or utilizing MO4-ntn1a
Phenotype Fish Conditions Figures
anterior commissure axon extension process quality, abnormal b1204Tg + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
vasculature development disrupted, abnormal la116Tg + MO4-ntn1a standard conditions Fig. 6 with image from Tu et al., 2015
whole organism lacks all parts of type parachordal vessel, abnormal la116Tg + MO4-ntn1a standard conditions Fig. 6 with image from Tu et al., 2015
blood vessel endothelial cell migration decreased process quality, abnormal is5Tg; y7Tg + MO4-ntn1a standard conditions Fig. S6 from Tu et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal is5Tg; y7Tg + MO4-ntn1a standard conditions Fig. 6 with image from Tu et al., 2015
blood vessel endothelial cell proliferation involved in sprouting angiogenesis decreased process quality, abnormal is5Tg; y7Tg + MO4-ntn1a standard conditions Fig. S6 from Tu et al., 2015
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
OTHER MO4-ntn1a MORPHOLINO PAGES No links to external sites
CITATIONS (3)