Morpholino

MO1-zic3

ID

ZDB-MRPHLNO-120322-1

Name

MO1-zic3

Previous Names

Zic3 TB MO (1)

Target

zic3 (1)

Sequence

5' - TATCAAGGAGCATAGTCATTGGGCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-zic3

Expressed Gene	Anatomy	Figures
dlx3b	neural plate	Fig. 3 from Cast et al., 2012
foxa3	gut	Fig. 6 from Cast et al., 2012
myl7	heart	Fig. 6 from Cast et al., 2012
myod1	somite	Fig. 3 from Cast et al., 2012
spaw	lateral plate mesoderm left side	Fig. 7 from Cast et al., 2012
tbxta	axial chorda mesoderm	Fig. 3 from Cast et al., 2012

Phenotype

Phenotype resulting from MO1-zic3

Phenotype	Fish	Figures
anterior/posterior axis specification disrupted, abnormal	AB + MO1-zic3	Fig. 4 from Cast et al., 2012
axis elongation disrupted, abnormal	AB + MO1-zic3	Fig. 3 from Cast et al., 2012
determination of left/right symmetry disrupted, abnormal	AB + MO1-zic3	Fig. 6 from Cast et al., 2012
digestive tract morphogenesis disrupted, abnormal	AB + MO1-zic3	Fig. 6 from Cast et al., 2012
gut lateralized, abnormal	AB + MO1-zic3	Fig. 6 from Cast et al., 2012
head increased distance post-vent region, abnormal	AB + MO1-zic3	Fig. 3 from Cast et al., 2012
heart mislocalised laterally, abnormal	AB + MO1-zic3	Fig. 6 from Cast et al., 2012
heart looping disrupted, abnormal	AB + MO1-zic3	Fig. 6 from Cast et al., 2012
liver mislocalised laterally, abnormal	AB + MO1-zic3	Fig. 6 from Cast et al., 2012
neural plate increased width, abnormal	AB + MO1-zic3	Fig. 3 from Cast et al., 2012
notochord increased width, abnormal	AB + MO1-zic3	Fig. 3 from Cast et al., 2012
pancreas mislocalised laterally, abnormal	AB + MO1-zic3	Fig. 6 from Cast et al., 2012
somite increased width, abnormal	AB + MO1-zic3	Fig. 3 from Cast et al., 2012
trunk increased curvature, abnormal	AB + MO1-zic3	Fig. 3 , Fig. 4 from Cast et al., 2012
trunk anterior-posterior axis shortened, abnormal	AB + MO1-zic3	Fig. 3 from Cast et al., 2012

Phenotype of all Fish created by or utilizing MO1-zic3

Phenotype	Fish	Conditions	Figures
heart mislocalised laterally, abnormal	AB + MO1-zic3	standard conditions	Fig. 6 from Cast et al., 2012
anterior/posterior axis specification disrupted, abnormal	AB + MO1-zic3	standard conditions	Fig. 4 from Cast et al., 2012
notochord increased width, abnormal	AB + MO1-zic3	standard conditions	Fig. 3 from Cast et al., 2012
heart looping disrupted, abnormal	AB + MO1-zic3	standard conditions	Fig. 6 from Cast et al., 2012
digestive tract morphogenesis disrupted, abnormal	AB + MO1-zic3	standard conditions	Fig. 6 from Cast et al., 2012
determination of left/right symmetry disrupted, abnormal	AB + MO1-zic3	standard conditions	Fig. 6 from Cast et al., 2012
axis elongation disrupted, abnormal	AB + MO1-zic3	standard conditions	Fig. 3 from Cast et al., 2012
head increased distance post-vent region, abnormal	AB + MO1-zic3	standard conditions	Fig. 3 from Cast et al., 2012
trunk increased curvature, abnormal	AB + MO1-zic3	standard conditions	Fig. 3 , Fig. 4 from Cast et al., 2012
pancreas mislocalised laterally, abnormal	AB + MO1-zic3	standard conditions	Fig. 6 from Cast et al., 2012
neural plate increased width, abnormal	AB + MO1-zic3	standard conditions	Fig. 3 from Cast et al., 2012
somite increased width, abnormal	AB + MO1-zic3	standard conditions	Fig. 3 from Cast et al., 2012
trunk anterior-posterior axis shortened, abnormal	AB + MO1-zic3	standard conditions	Fig. 3 from Cast et al., 2012
gut lateralized, abnormal	AB + MO1-zic3	standard conditions	Fig. 6 from Cast et al., 2012
liver mislocalised laterally, abnormal	AB + MO1-zic3	standard conditions	Fig. 6 from Cast et al., 2012

Citations