ZFIN ID: ZDB-MRPHLNO-120320-2
Morpholino Name: MO3-wnt1
Target: wnt1 (1)
Sequence:
5' - GATTCACGCAATAGCACACACTGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO. Targets the 5 prime UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-wnt1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-wnt1 No data available
PHENOTYPE
Phenotype resulting from MO3-wnt1
No data available

Phenotype of all Fish created by or utilizing MO3-wnt1
No data available
OTHER MO3-wnt1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)