ZFIN ID: ZDB-MRPHLNO-120217-1
Morpholino Name: MO4-sox19b
Target: sox19b (1)
Previous Name: sb-1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACATTTGACTGTGGAGAGGAAAAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-sox19b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-sox19b
Expressed Gene Anatomy Figures
ccnd1 Fig. 2 from Hu et al., 2012
chrd Fig. 2 from Hu et al., 2012
eve1 Fig. 2 from Hu et al., 2012
fbxw11a Fig. 2 from Hu et al., 2012
gsc Fig. 1 from Hu et al., 2012
mos Fig. 2 from Hu et al., 2012
rbl1 Fig. 2 from Hu et al., 2012
rps6ka1 Fig. 2 from Hu et al., 2012
tbx16 Fig. 2 from Hu et al., 2012
tbxta Fig. 1 from Hu et al., 2012
PHENOTYPE
Phenotype resulting from MO4-sox19b
Phenotype of all Fish created by or utilizing MO4-sox19b
Genome Resources:
CITATIONS (1)