header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120215-5
Morpholino Name: MO1-grem2b
Target: grem2b (1)
Sequence:
5' - GACACAGCGCCACCTTACTGCTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-grem2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-grem2b
Expressed Gene Anatomy Figures
dlx3b Fig. 7 with image from Zuniga et al., 2011
hand2 Fig. 7 with image from Zuniga et al., 2011
PHENOTYPE
Phenotype resulting from MO1-grem2b
Phenotype of all Fish created by or utilizing MO1-grem2b
OTHER MO1-grem2b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)