ZFIN ID: ZDB-MRPHLNO-111209-8
Morpholino Name: MO1-twist2
Target: twist2 (1)
Previous Name: twist2 atgMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGAGCTAGAACTCTCTTCCATTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-twist2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-twist2
Expressed Gene Anatomy Figures
runx2b Fig. S2 with image from Yang et al., 2011
PHENOTYPE
Phenotype resulting from MO1-twist2
No data available

Phenotype of all Fish created by or utilizing MO1-twist2
No data available
OTHER MO1-twist2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)