ZFIN ID: ZDB-MRPHLNO-111014-3
Morpholino Name: MO1-sfrp1a
Target: sfrp1a (1)
Sequence:
5' - GGACAAAGATGCAAGGGACTTCATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-sfrp1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-sfrp1a
Expressed Gene Anatomy Figures
chrd Fig. 3 with image from Lu et al., 2011
PHENOTYPE
Phenotype resulting from MO1-sfrp1a
No data available

Phenotype of all Fish created by or utilizing MO1-sfrp1a
No data available
OTHER MO1-sfrp1a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)