header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110823-1
Morpholino Name: MO5-sox2,sox3
Targets: sox2 (1), sox3 (1)
Previous Names: MO5-sox2+sox3, sox2/sox3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTCGGTTTCCATCATGTTATACATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-sox2,sox3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-sox2,sox3 No data available
PHENOTYPE
Phenotype resulting from MO5-sox2,sox3
No data available

Phenotype of all Fish created by or utilizing MO5-sox2,sox3
Genome Resources:
CITATIONS (3)