Morpholino

MO1-tbx2

ID

ZDB-MRPHLNO-110718-2

Name

MO1-tbx2

Previous Names

MO2ab (1)

Targets

tbx2a (1)
tbx2b (1)

Sequence

5' - AAAACTGGATCTCTCATCGGTGCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a translation-blocking MO that targets the translation start sites of both tbx2a and tbx2b.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tbx2

Expressed Gene	Anatomy	Figures
mecom	pronephric duct	Fig. 8 from Morales et al., 2018
myl7	cardiac muscle cell	Fig. 10 from Sedletcaia et al., 2011
ndrg4	(not) cardiac ventricle whole organism	Fig. 10 , Fig. 11 from Sedletcaia et al., 2011
nppa	cardiac ventricle whole organism	Fig. 10 , Fig. 11 from Sedletcaia et al., 2011
sim1a	corpuscles of Stannius	Fig. 4 from Drummond et al., 2017
slc12a1	pronephric distal early tubule	Fig. 3 from Drummond et al., 2017
slc12a3	pronephric distal late tubule	Fig. 3 from Drummond et al., 2017
slc20a1a	pronephric proximal convoluted tubule	Fig. 3 from Drummond et al., 2017
smyhc1	somite	Fig. 3 from Drummond et al., 2017
stc1	corpuscles of Stannius	Fig. 4 , Fig. 9 from Drummond et al., 2017
trpm7	pronephric proximal straight tubule	Fig. 3 from Drummond et al., 2017

Phenotype

Phenotype resulting from MO1-tbx2

No data available

Phenotype of all Fish created by or utilizing MO1-tbx2

Phenotype	Fish	Conditions	Figures
heart tube position, abnormal	AB/TU + MO1-tbx2	standard conditions	Fig. 4 from Sedletcaia et al., 2011
cardiac muscle cell proliferation decreased occurrence, abnormal	AB/TU + MO1-tbx2	standard conditions	Fig. 8 from Sedletcaia et al., 2011
heart malformed, abnormal	AB/TU + MO1-tbx2	standard conditions	Fig. 3 from Sedletcaia et al., 2011
heart jogging disrupted, abnormal	AB/TU + MO1-tbx2	standard conditions	Fig. 4 from Sedletcaia et al., 2011
pericardium edematous, abnormal	AB/TU + MO1-tbx2	standard conditions	Fig. 3 from Sedletcaia et al., 2011
corpuscles of Stannius sim1a expression increased distribution, abnormal	TU + MO1-tbx2	standard conditions	Fig. 4 from Drummond et al., 2017
pronephric proximal convoluted tubule increased length, abnormal	TU + MO1-tbx2	standard conditions	Fig. 3 from Drummond et al., 2017
corpuscles of Stannius cell increased amount, abnormal	TU + MO1-tbx2	standard conditions	Fig. 4 , Fig. 9 from Drummond et al., 2017
pronephric distal late tubule decreased length, abnormal	TU + MO1-tbx2	standard conditions	Fig. 3 from Drummond et al., 2017
corpuscles of Stannius cell increased amount, abnormal	TU + MO1-tbx2	chemical treatment by environment: DAPT	Fig. 9 from Drummond et al., 2017
corpuscles of Stannius stc1 expression increased distribution, abnormal	TU + MO1-tbx2	chemical treatment by environment: DAPT	Fig. 9 from Drummond et al., 2017
corpuscles of Stannius stc1 expression increased distribution, abnormal	TU + MO1-tbx2	standard conditions	Fig. 4 , Fig. 9 from Drummond et al., 2017
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	TU + MO1-tbx2	standard conditions	Fig. 3 from Drummond et al., 2017
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal	TU + MO1-tbx2	standard conditions	Fig. 3 from Drummond et al., 2017
cardiac ventricle cardiac muscle cell decreased amount, abnormal	f2Tg + MO1-tbx2	standard conditions	Fig. 6 , Fig. 7 from Sedletcaia et al., 2011
atrium increased size, abnormal	twu26Tg + MO1-tbx2	standard conditions	Fig. 4 , Fig. 5 from Sedletcaia et al., 2011
cardiac ventricle decreased size, abnormal	twu26Tg + MO1-tbx2	standard conditions	Fig. 4 , Fig. 5 from Sedletcaia et al., 2011
corpuscles of Stannius cell increased amount, abnormal	kca3Tg; kca4Tg + MO1-tbx2	heat shock	Fig. 9 from Drummond et al., 2017
corpuscles of Stannius stc1 expression increased distribution, abnormal	kca3Tg; kca4Tg + MO1-tbx2	heat shock	Fig. 9 from Drummond et al., 2017

Citations