ZFIN ID: ZDB-MRPHLNO-110621-1
Morpholino Name: MO4-tnfa
Target: tnfa (1)
Sequence:
5' - GCAGGATTTTCACCTTATGGAGCGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-tnfa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-tnfa No data available
PHENOTYPE
Phenotype resulting from MO4-tnfa
Phenotype Figures
autophagy increased occurrence, abnormal Fig. 7 with image from Espín-Palazón et al., 2016
whole organism EGFP expression increased amount, abnormal Fig. 7 with image from Espín-Palazón et al., 2016

Phenotype of all Fish created by or utilizing MO4-tnfa
Phenotype Fish Conditions Figures
defense response to bacterium disrupted, abnormal AB + MO4-tnfa bacterial treatment: Mycobacterium marinum Fig. 4 with image from Tobin et al., 2012
inflammatory response to antigenic stimulus process quality, abnormal AB + MO4-tnfa bacterial treatment: Mycobacterium marinum Fig. 4 with image from Tobin et al., 2012
whole organism life span, ameliorated AB + MO4-tnfa viral treatment by exposure to environment: Carp sprivivirus Fig. 1 from Espín-Palazón et al., 2016
glial cell EGFP expression absent, abnormal nc1Tg + MO4-tnfa control Fig. 5 with image from Smith et al., 2017
glial cell Eos expression decreased amount, abnormal w9Tg + MO4-tnfa control Fig. 4 with image from Smith et al., 2017
dorsal root ganglion peripheral nervous system axon ensheathment decreased occurrence, abnormal w9Tg + MO4-tnfa control Fig. 4 with image from Smith et al., 2017
autophagy increased occurrence, abnormal zf155Tg + MO4-tnfa control Fig. 7 with image from Espín-Palazón et al., 2016
whole organism EGFP expression increased amount, abnormal zf155Tg + MO4-tnfa viral treatment by exposure to environment: Carp sprivivirus Fig. 7 with image from Espín-Palazón et al., 2016
whole organism EGFP expression increased amount, abnormal zf155Tg + MO4-tnfa control Fig. 7 with image from Espín-Palazón et al., 2016
autophagy increased occurrence, exacerbated zf155Tg + MO4-tnfa viral treatment by exposure to environment: Carp sprivivirus Fig. 7 with image from Espín-Palazón et al., 2016
intestinal epithelial cell decreased height, abnormal uhrf1pd1092/pd1092; pd1028Tg + MO4-tnfa standard conditions Fig. 4 with image from Marjoram et al., 2015
OTHER MO4-tnfa MORPHOLINO PAGESNo links to external sites
CITATIONS (8)