Morpholino

MO2-thsd7aa

ID

ZDB-MRPHLNO-110531-2

Name

MO2-thsd7aa

Previous Names

None

Target

thsd7aa (1)

Sequence

5' - GTGCCAGTTTTGTTACCGTCTTTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-thsd7aa

No data available

Phenotype

Phenotype resulting from MO2-thsd7aa

Phenotype	Fish	Figures
blood vessel endothelial cell migration disrupted, abnormal	y1Tg + MO2-thsd7aa	Fig. 5 from Wang et al., 2011
endothelial tip cell cell projection morphology, abnormal	y1Tg + MO2-thsd7aa	Fig. S3 from Liu et al., 2016
intersegmental vessel increased branchiness, abnormal	y1Tg + MO2-thsd7aa	Fig. 4 from Wang et al., 2011
intersegmental vessel spatial pattern, abnormal	y1Tg + MO2-thsd7aa	Fig. 4 , Fig. 5 from Wang et al., 2011

Phenotype of all Fish created by or utilizing MO2-thsd7aa

Phenotype	Fish	Conditions	Figures
endothelial tip cell cell projection morphology, abnormal	y1Tg + MO2-thsd7aa	standard conditions	Fig. S3 from Liu et al., 2016
intersegmental vessel spatial pattern, abnormal	y1Tg + MO2-thsd7aa	standard conditions	Fig. 4 , Fig. 5 from Wang et al., 2011
blood vessel endothelial cell migration disrupted, abnormal	y1Tg + MO2-thsd7aa	standard conditions	Fig. 5 from Wang et al., 2011
intersegmental vessel increased branchiness, abnormal	y1Tg + MO2-thsd7aa	standard conditions	Fig. 4 from Wang et al., 2011
parachordal vessel angiogenesis decreased occurrence, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
RoP motor neuron axon development decreased occurrence, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
MiP motor neuron axon development process quality, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
secondary motor neuron axon development process quality, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
RoP motor neuron axon absent, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
MiP motor neuron axon morphology, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
MiP motor neuron axon decreased length, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
parachordal vessel absent, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
RoP motor neuron axon morphology, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
parachordal vessel aplastic, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
secondary motor neuron axon morphology, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016
horizontal myoseptum lacks parts or has fewer parts of type RoP motor neuron axon, abnormal	s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa	standard conditions	Fig. 3 from Liu et al., 2016

Citations