Morpholino

MO4-nr3c1

ID
ZDB-MRPHLNO-110325-5
Name
MO4-nr3c1
Previous Names
  • grsplicMO (1)
Target
Sequence
5' - GCCAGAGATATATGGAATACCTTCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-nr3c1
Expressed Gene Anatomy Figures
egln3 Fig. 3 with image from Vettori et al., 2017
fkbp5 Fig. S3 with image from Vettori et al., 2017
irg1l Fig. 3 from Hall et al., 2014
Phenotype
Phenotype resulting from MO4-nr3c1
Phenotype Fish Figures
ceratohyal cartilage disoriented, abnormal WT + MO4-nr3c1 Fig. 5 with image from Pikulkaew et al., 2011
ceratohyal cartilage fused with hypobranchial cartilage, abnormal WT + MO4-nr3c1 Fig. 5 with image from Pikulkaew et al., 2011
ethmoid cartilage curled, abnormal WT + MO4-nr3c1 Fig. 5 with image from Pikulkaew et al., 2011
ethmoid cartilage retracted, abnormal WT + MO4-nr3c1 Fig. 5 with image from Pikulkaew et al., 2011
Meckel's cartilage decreased size, abnormal WT + MO4-nr3c1 Fig. 5 with image from Pikulkaew et al., 2011
Meckel's cartilage disoriented, abnormal WT + MO4-nr3c1 Fig. 5 with image from Pikulkaew et al., 2011
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO4-nr3c1 Fig. 5 with image from Pikulkaew et al., 2011
whole organism fkbp5 expression decreased amount, abnormal ia21Tg + MO4-nr3c1 Fig. S3 with image from Vettori et al., 2017
Phenotype of all Fish created by or utilizing MO4-nr3c1
Phenotype Fish Conditions Figures
ethmoid cartilage retracted, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
ceratohyal cartilage fused with hypobranchial cartilage, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
ethmoid cartilage curled, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
head epidermis irg1l expression mislocalised, abnormal WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 from Hall et al., 2014
whole organism egln3 expression amount, ameliorated WT + MO4-nr3c1 chemical treatment: dexamethasone Fig. 3 with image from Vettori et al., 2017
Meckel's cartilage disoriented, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
macrophage acod1 expression amount, ameliorated WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 with image from Hall et al., 2013
epithelial cell irg1l expression mislocalised, abnormal WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 from Hall et al., 2014
neuromast epithelium irg1l expression mislocalised, abnormal WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 from Hall et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
olfactory epithelium irg1l expression mislocalised, abnormal WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 from Hall et al., 2014
blood macrophage cebpb expression amount, ameliorated WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 with image from Hall et al., 2013
ceratohyal cartilage disoriented, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
whole organism EGFP expression amount, ameliorated ia21Tg + MO4-nr3c1 chemical treatment: dexamethasone Fig. 3 with image from Vettori et al., 2017
whole organism fkbp5 expression decreased amount, abnormal ia21Tg + MO4-nr3c1 control Fig. S3 with image from Vettori et al., 2017
macrophage acod1 expression amount, ameliorated WT + MO2-stat3 + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 4 with image from Hall et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.