ZFIN ID: ZDB-MRPHLNO-101207-2
Morpholino Name: MO1-apobb.1
Target: apobb.1 (1)
Previous Name: MO1-apobl (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCATGATGGGTTCAGGTAAGCTCGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-apobb.1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-apobb.1
Expressed Gene Anatomy Figures
atoh7 Fig. 7 with image from Seth et al., 2010
isl1 Fig. 7 with image from Seth et al., 2010
pax2a Fig. 7 with image from Seth et al., 2010
PHENOTYPE
Phenotype resulting from MO1-apobb.1
Phenotype Figures
optic stalk decreased length, abnormal Fig. 7 with image from Seth et al., 2010
optic stalk increased thickness, abnormal Fig. 7 with image from Seth et al., 2010
retinal ganglion cell decreased amount, abnormal Fig. 7 with image from Seth et al., 2010
whole organism lacks all parts of type optic chiasm, abnormal Fig. 7 with image from Seth et al., 2010

Phenotype of all Fish created by or utilizing MO1-apobb.1
Phenotype Fish Conditions Figures
retinal ganglion cell decreased amount, abnormal AB + MO1-apobb.1 standard conditions Fig. 7 with image from Seth et al., 2010
optic stalk decreased length, abnormal AB + MO1-apobb.1 standard conditions Fig. 7 with image from Seth et al., 2010
optic stalk increased thickness, abnormal AB + MO1-apobb.1 standard conditions Fig. 7 with image from Seth et al., 2010
whole organism lacks all parts of type optic chiasm, abnormal AB + MO1-apobb.1 standard conditions Fig. 7 with image from Seth et al., 2010
OTHER MO1-apobb.1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)