Morpholino

MO1-id2a

ID
ZDB-MRPHLNO-101111-5
Name
MO1-id2a
Previous Names
None
Target
Sequence
5' - GCCTTCATGTTGACAGCAGGATTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-id2a
Expressed Gene Anatomy Figures
ascl1a Fig. 3 with image from Uribe et al., 2012
atoh7 Fig. 4 with image from Uribe et al., 2010
ccnd1 Fig. 7 with image from Uribe et al., 2012
cdk6 Fig. 7 with image from Uribe et al., 2012
cdkn1a Fig. 7 with image from Uribe et al., 2012
cdx1b Fig. 3 with image from Khaliq et al., 2015
cp Fig. 3 with image from Khaliq et al., 2015
crx Fig. 4 with image from Uribe et al., 2010
dla Fig. 3 with image from Uribe et al., 2012
dlc Fig. 3 with image from Uribe et al., 2012
dlx2a Fig. 10 with image from Das et al., 2012
fabp10a Fig. 3 with image from Khaliq et al., 2015
fli1 Fig. 10 with image from Das et al., 2012
fzd6 Fig. 7 with image from Uribe et al., 2012
her4.1 Fig. 3 with image from Uribe et al., 2012
hes6 Fig. 3 with image from Uribe et al., 2012
hhex Fig. S13 with image from Xu et al., 2016
Fig. 3 with image from Khaliq et al., 2015
ins Fig. S2 with image from Khaliq et al., 2015
neurod4 Fig. 4 with image from Uribe et al., 2010
notch1a Fig. 3 with image from Uribe et al., 2012
pdx1 Fig. S13 with image from Xu et al., 2016
prox1a Fig. 3 with image from Khaliq et al., 2015
rspo1 Fig. 7 with image from Uribe et al., 2012
selenop2 Fig. 3 with image from Khaliq et al., 2015
skp2 Fig. 7 with image from Uribe et al., 2012
sox10 Fig. 10 with image from Das et al., 2012
tcf7l1b Fig. 7 with image from Uribe et al., 2012
tfap2a Fig. 4 with image from Uribe et al., 2010
Phenotype
Phenotype resulting from MO1-id2a
Phenotype Fish Figures
amacrine cell ab-5e11 labeling absent, abnormal WT + MO1-id2a Fig. 2 with image from Uribe et al., 2012
amacrine cell absent, abnormal WT + MO1-id2a Fig. 2 with imageFig. 5 with image from Uribe et al., 2012
Fig. 2 with image from Uribe et al., 2010
amacrine cell differentiation arrested, abnormal WT + MO1-id2a Fig. 2 with image from Uribe et al., 2012
brain decreased size, abnormal WT + MO1-id2a Fig. 1 with image from Uribe et al., 2010
camera-type eye photoreceptor cell differentiation disrupted, abnormal WT + MO1-id2a Fig. 5 with image from Uribe et al., 2012
Fig. 2 with image from Uribe et al., 2010
embryonic retina morphogenesis in camera-type eye delayed, abnormal WT + MO1-id2a Fig. 4 with imageFig. 5 with image from Uribe et al., 2010
eye decreased size, abnormal WT + MO1-id2a Fig. 4 with image from Uribe et al., 2012
Fig. 1 with imageFig. 5 with image from Uribe et al., 2010
eye cell decreased amount, abnormal WT + MO1-id2a Fig. 4 with image from Uribe et al., 2012
eye photoreceptor cell differentiation decreased process quality, abnormal WT + MO1-id2a Fig. 1 with image from Uribe et al., 2012
intestinal bulb decreased size, abnormal WT + MO1-id2a Fig. 3 with image from Khaliq et al., 2015
intrahepatic bile duct aggregated, abnormal gz15Tg; um14Tg + MO1-id2a Fig. 3 with image from Khaliq et al., 2015
intrahepatic bile duct decreased branchiness, abnormal gz15Tg; um14Tg + MO1-id2a Fig. 3 with image from Khaliq et al., 2015
intrahepatic bile duct epithelial cell GFP expression decreased amount, abnormal gz15Tg; um14Tg + MO1-id2a Fig. 3 with image from Khaliq et al., 2015
intrahepatic bile duct epithelial cell GFP expression spatial pattern, abnormal gz15Tg; um14Tg + MO1-id2a Fig. 3 with image from Khaliq et al., 2015
liver EGFP expression absent, abnormal um14Tg ; jh1Tg + MO1-id2a Fig. 3 with image from Khaliq et al., 2015
liver DsRed expression decreased amount, abnormal gz15Tg + MO1-id2a Fig. S1 with image from Khaliq et al., 2015
liver hhex expression decreased amount, abnormal WT + MO1-id2a Fig. S13 with image from Xu et al., 2016
liver decreased size, abnormal gz15Tg; um14Tg + MO1-id2a Fig. 3 with imageFig. S1 with image from Khaliq et al., 2015
liver apoptotic process increased occurrence, abnormal WT + MO1-id2a Fig. 4 with image from Khaliq et al., 2015
liver cell population proliferation decreased occurrence, abnormal s870Tg + MO1-id2a Fig. 4 with image from Khaliq et al., 2015
Muller cell decreased amount, abnormal WT + MO1-id2a Fig. 2 with image from Uribe et al., 2010
regulation of neural retina development disrupted, abnormal WT + MO1-id2a Fig. 4 with image from Uribe et al., 2010
retina ccnd1 expression increased amount, abnormal WT + MO1-id2a Fig. 7 with image from Uribe et al., 2012
retina her4.1 expression increased amount, abnormal WT + MO1-id2a Fig. 3 with image from Uribe et al., 2012
retina skp2 expression increased amount, abnormal WT + MO1-id2a Fig. 7 with image from Uribe et al., 2012
retina notch1a expression increased amount, abnormal WT + MO1-id2a Fig. 3 with image from Uribe et al., 2012
retina dlc expression increased amount, abnormal WT + MO1-id2a Fig. 3 with image from Uribe et al., 2012
retina ascl1a expression increased amount, abnormal WT + MO1-id2a Fig. 3 with image from Uribe et al., 2012
retina fzd6 expression increased amount, abnormal WT + MO1-id2a Fig. 7 with image from Uribe et al., 2012
retina dla expression increased amount, abnormal WT + MO1-id2a Fig. 3 with image from Uribe et al., 2012
retina hes6 expression increased amount, abnormal WT + MO1-id2a Fig. 3 with image from Uribe et al., 2012
retina cdk6 expression increased amount, abnormal WT + MO1-id2a Fig. 7 with image from Uribe et al., 2012
retina rspo1 expression increased amount, abnormal WT + MO1-id2a Fig. 7 with image from Uribe et al., 2012
retina cdkn1a expression increased amount, abnormal WT + MO1-id2a Fig. 7 with image from Uribe et al., 2012
retina tcf7l1b expression increased amount, abnormal WT + MO1-id2a Fig. 7 with image from Uribe et al., 2012
retina dla expression increased distribution, abnormal WT + MO1-id2a Fig. 3 with image from Uribe et al., 2012
retina notch1a expression increased distribution, abnormal WT + MO1-id2a Fig. 3 with image from Uribe et al., 2012
retina ascl1a expression increased distribution, abnormal WT + MO1-id2a Fig. 3 with image from Uribe et al., 2012
retina cell decreased amount, abnormal WT + MO1-id2a Fig. 1 with image from Uribe et al., 2012
retina cell population proliferation process quality, abnormal WT + MO1-id2a Fig. 1 with imageFig. 4 with image from Uribe et al., 2012
retina layer formation disrupted, abnormal WT + MO1-id2a Fig. 1 with image from Uribe et al., 2010
retinal bipolar neuron absent, abnormal WT + MO1-id2a Fig. 2 with image from Uribe et al., 2010
retinal bipolar neuron differentiation disrupted, abnormal WT + MO1-id2a Fig. 2 with image from Uribe et al., 2010
retinal cone cell zpr-1 labeling absent, abnormal WT + MO1-id2a Fig. 2 with image from Uribe et al., 2012
retinal cone cell absent, abnormal WT + MO1-id2a Fig. 2 with imageFig. 5 with image from Uribe et al., 2012
Fig. 2 with image from Uribe et al., 2010
retinal cone cell differentiation arrested, abnormal WT + MO1-id2a Fig. 2 with image from Uribe et al., 2012
retinal inner nuclear layer unstructured, abnormal WT + MO1-id2a Fig. 1 with image from Uribe et al., 2010
retinal inner nuclear layer cell undifferentiated, abnormal WT + MO1-id2a Fig. 2 with image from Uribe et al., 2010
retinal outer nuclear layer unstructured, abnormal WT + MO1-id2a Fig. 1 with image from Uribe et al., 2010
retinal outer nuclear layer cell undifferentiated, abnormal WT + MO1-id2a Fig. 2 with image from Uribe et al., 2010
retinal rod cell decreased amount, abnormal WT + MO1-id2a Fig. 2 with image from Uribe et al., 2010
S phase delayed, abnormal WT + MO1-id2a Fig. 5 with image from Uribe et al., 2010
Phenotype of all Fish created by or utilizing MO1-id2a
Phenotype Fish Conditions Figures
retina cell decreased amount, abnormal WT + MO1-id2a control Fig. 1 with image from Uribe et al., 2012
retina rspo1 expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 7 with image from Uribe et al., 2012
retina tcf7l1b expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 7 with image from Uribe et al., 2012
retina hes6 expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 3 with image from Uribe et al., 2012
liver hhex expression decreased amount, abnormal WT + MO1-id2a standard conditions Fig. S13 with image from Xu et al., 2016
brain decreased size, abnormal WT + MO1-id2a standard conditions Fig. 1 with image from Uribe et al., 2010
amacrine cell amount, ameliorated WT + MO1-id2a chemical treatment: DAPT Fig. 2 with image from Uribe et al., 2012
liver apoptotic process increased occurrence, abnormal WT + MO1-id2a standard conditions Fig. 4 with image from Khaliq et al., 2015
retinal cone cell amount, ameliorated WT + MO1-id2a chemical treatment: DAPT Fig. 2 with image from Uribe et al., 2012
retina notch1a expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 3 with image from Uribe et al., 2012
retina cell population proliferation process quality, ameliorated WT + MO1-id2a chemical treatment: DAPT Fig. 1 with image from Uribe et al., 2012
retina dla expression increased distribution, abnormal WT + MO1-id2a standard conditions Fig. 3 with image from Uribe et al., 2012
retina her4.1 expression increased amount, abnormal WT + MO1-id2a control Fig. 3 with image from Uribe et al., 2012
S phase delayed, abnormal WT + MO1-id2a standard conditions Fig. 5 with image from Uribe et al., 2010
retinal inner nuclear layer cell undifferentiated, abnormal WT + MO1-id2a standard conditions Fig. 2 with image from Uribe et al., 2010
retina ascl1a expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 3 with image from Uribe et al., 2012
retina dla expression increased amount, abnormal WT + MO1-id2a control Fig. 3 with image from Uribe et al., 2012
Muller cell decreased amount, abnormal WT + MO1-id2a standard conditions Fig. 2 with image from Uribe et al., 2010
amacrine cell absent, abnormal WT + MO1-id2a standard conditions Fig. 2 with imageFig. 5 with image from Uribe et al., 2012
Fig. 2 with image from Uribe et al., 2010
eye photoreceptor cell differentiation decreased process quality, abnormal WT + MO1-id2a control Fig. 1 with image from Uribe et al., 2012
retina skp2 expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 7 with image from Uribe et al., 2012
retinal cone cell differentiation process quality, ameliorated WT + MO1-id2a chemical treatment: DAPT Fig. 2 with image from Uribe et al., 2012
retina ascl1a expression increased distribution, abnormal WT + MO1-id2a standard conditions Fig. 3 with image from Uribe et al., 2012
retinal cone cell zpr-1 labeling absent, abnormal WT + MO1-id2a control Fig. 2 with image from Uribe et al., 2012
retinal rod cell decreased amount, abnormal WT + MO1-id2a standard conditions Fig. 2 with image from Uribe et al., 2010
regulation of neural retina development disrupted, abnormal WT + MO1-id2a standard conditions Fig. 4 with image from Uribe et al., 2010
eye cell decreased amount, abnormal WT + MO1-id2a standard conditions Fig. 4 with image from Uribe et al., 2012
intestinal bulb decreased size, abnormal WT + MO1-id2a standard conditions Fig. 3 with image from Khaliq et al., 2015
retina cell amount, ameliorated WT + MO1-id2a chemical treatment: DAPT Fig. 1 with image from Uribe et al., 2012
retina cdkn1a expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 7 with image from Uribe et al., 2012
retina fzd6 expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 7 with image from Uribe et al., 2012
retinal bipolar neuron absent, abnormal WT + MO1-id2a standard conditions Fig. 2 with image from Uribe et al., 2010
retinal cone cell zpr-1 labeling amount, ameliorated WT + MO1-id2a chemical treatment: DAPT Fig. 2 with image from Uribe et al., 2012
retinal outer nuclear layer cell undifferentiated, abnormal WT + MO1-id2a standard conditions Fig. 2 with image from Uribe et al., 2010
camera-type eye photoreceptor cell differentiation disrupted, abnormal WT + MO1-id2a standard conditions Fig. 5 with image from Uribe et al., 2012
Fig. 2 with image from Uribe et al., 2010
embryonic retina morphogenesis in camera-type eye delayed, abnormal WT + MO1-id2a chemical treatment: 5-bromo-2'-deoxyuridine Fig. 7 with image from Uribe et al., 2010
retina layer formation disrupted, abnormal WT + MO1-id2a standard conditions Fig. 1 with image from Uribe et al., 2010
retina cdk6 expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 7 with image from Uribe et al., 2012
retina ccnd1 expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 7 with image from Uribe et al., 2012
S phase delayed, abnormal WT + MO1-id2a chemical treatment: 5-bromo-2'-deoxyuridine Fig. 7 with image from Uribe et al., 2010
liver decreased size, abnormal WT + MO1-id2a standard conditions Fig. 3 with image from Khaliq et al., 2015
retinal cone cell absent, abnormal WT + MO1-id2a standard conditions Fig. 2 with imageFig. 5 with image from Uribe et al., 2012
Fig. 2 with image from Uribe et al., 2010
amacrine cell ab-5e11 labeling amount, ameliorated WT + MO1-id2a chemical treatment: DAPT Fig. 2 with image from Uribe et al., 2012
retinal bipolar neuron differentiation disrupted, abnormal WT + MO1-id2a standard conditions Fig. 2 with image from Uribe et al., 2010
amacrine cell differentiation process quality, ameliorated WT + MO1-id2a chemical treatment: DAPT Fig. 2 with image from Uribe et al., 2012
embryonic retina morphogenesis in camera-type eye delayed, abnormal WT + MO1-id2a standard conditions Fig. 4 with imageFig. 5 with image from Uribe et al., 2010
retina cell population proliferation process quality, abnormal WT + MO1-id2a control Fig. 1 with imageFig. 4 with image from Uribe et al., 2012
retinal outer nuclear layer unstructured, abnormal WT + MO1-id2a standard conditions Fig. 1 with image from Uribe et al., 2010
retina dlc expression increased amount, abnormal WT + MO1-id2a standard conditions Fig. 3 with image from Uribe et al., 2012
eye decreased size, abnormal WT + MO1-id2a standard conditions Fig. 4 with image from Uribe et al., 2012
Fig. 1 with imageFig. 5 with image from Uribe et al., 2010
retinal cone cell differentiation arrested, abnormal WT + MO1-id2a control Fig. 2 with image from Uribe et al., 2012
amacrine cell ab-5e11 labeling absent, abnormal WT + MO1-id2a control Fig. 2 with image from Uribe et al., 2012
retina notch1a expression increased distribution, abnormal WT + MO1-id2a standard conditions Fig. 3 with image from Uribe et al., 2012
amacrine cell differentiation arrested, abnormal WT + MO1-id2a control Fig. 2 with image from Uribe et al., 2012
retinal inner nuclear layer unstructured, abnormal WT + MO1-id2a standard conditions Fig. 1 with image from Uribe et al., 2010
liver DsRed expression decreased amount, abnormal gz15Tg + MO1-id2a standard conditions Fig. S1 with image from Khaliq et al., 2015
liver decreased size, abnormal gz15Tg + MO1-id2a standard conditions Fig. S1 with image from Khaliq et al., 2015
liver DsRed expression decreased amount, abnormal gz15Tg + MO1-id2a + MO4-tp53 standard conditions Fig. S1 with image from Khaliq et al., 2015
liver decreased size, abnormal gz15Tg + MO1-id2a + MO4-tp53 standard conditions Fig. S1 with image from Khaliq et al., 2015
liver cell population proliferation decreased occurrence, abnormal s870Tg + MO1-id2a standard conditions Fig. 4 with image from Khaliq et al., 2015
intrahepatic bile duct decreased branchiness, abnormal gz15Tg; um14Tg + MO1-id2a standard conditions Fig. 3 with image from Khaliq et al., 2015
liver decreased size, abnormal gz15Tg; um14Tg + MO1-id2a standard conditions Fig. 3 with image from Khaliq et al., 2015
intrahepatic bile duct epithelial cell GFP expression decreased amount, abnormal gz15Tg; um14Tg + MO1-id2a standard conditions Fig. 3 with image from Khaliq et al., 2015
intrahepatic bile duct aggregated, abnormal gz15Tg; um14Tg + MO1-id2a standard conditions Fig. 3 with image from Khaliq et al., 2015
intrahepatic bile duct epithelial cell GFP expression spatial pattern, abnormal gz15Tg; um14Tg + MO1-id2a standard conditions Fig. 3 with image from Khaliq et al., 2015
liver EGFP expression absent, abnormal um14Tg ; jh1Tg + MO1-id2a standard conditions Fig. 3 with image from Khaliq et al., 2015
intestine pdx1 expression decreased distribution, abnormal WT + MO1-fhl1b + MO1-id2a + MO2-fhl1b standard conditions Fig. S13 with image from Xu et al., 2016
intestine hhex expression decreased distribution, abnormal WT + MO1-fhl1b + MO1-id2a + MO2-fhl1b standard conditions Fig. S13 with image from Xu et al., 2016
posterior pancreatic bud hhex expression increased distribution, abnormal WT + MO1-fhl1b + MO1-id2a + MO2-fhl1b standard conditions Fig. S13 with image from Xu et al., 2016
posterior pancreatic bud pdx1 expression increased distribution, abnormal WT + MO1-fhl1b + MO1-id2a + MO2-fhl1b standard conditions Fig. S13 with image from Xu et al., 2016
eye cell amount, ameliorated WT + MO1-id2a + MO1-notch1a standard conditions Fig. 4 with image from Uribe et al., 2012
amacrine cell amount, ameliorated WT + MO1-id2a + MO1-notch1a control Fig. 5 with image from Uribe et al., 2012
camera-type eye photoreceptor cell differentiation process quality, ameliorated WT + MO1-id2a + MO1-notch1a control Fig. 5 with image from Uribe et al., 2012
retinal cone cell amount, ameliorated WT + MO1-id2a + MO1-notch1a control Fig. 5 with image from Uribe et al., 2012
retina cell population proliferation process quality, ameliorated WT + MO1-id2a + MO1-notch1a standard conditions Fig. 4 with image from Uribe et al., 2012
Citations