header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-101021-9
Morpholino Name: MO1-kdm1a
Target: kdm1a (1)
Sequence:
5' - GGTCTGACTTCTTATTGGACAACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-kdm1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-kdm1a
Expressed Gene Anatomy Figures
fabp2 Fig. 7 with image from Rai et al., 2010
rbp3 Fig. 7 with image from Rai et al., 2010
PHENOTYPE
Phenotype resulting from MO1-kdm1a
No data available

Phenotype of all Fish created by or utilizing MO1-kdm1a
Genome Resources:
CITATIONS (1)