ZFIN ID: ZDB-MRPHLNO-100624-9
Morpholino Name: MO1-pdzd7a
Target: pdzd7a (1)
Previous Name: pdzd7aMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTTGAGACTCACCATCGACAGGCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targeted to splice donor site of exon 1
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pdzd7a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pdzd7a
Expressed Gene Anatomy Figures
adgrv1 eye photoreceptor cell synapse Fig. 5 from Ebermann et al., 2010
pdzd7a (not) eye photoreceptor cell photoreceptor connecting cilium, (not) whole organism Fig. 4Fig. 5 from Ebermann et al., 2010
PHENOTYPE 
Phenotype resulting from MO1-pdzd7a
Phenotype Figures
anterior crista stereocilium bundle malformed, abnormal Fig. 5 from Ebermann et al., 2010
eye photoreceptor cell apoptotic, abnormal Fig. 5 from Ebermann et al., 2010
eye photoreceptor cell photoreceptor connecting cilium physical object quality, abnormal Fig. 5 from Ebermann et al., 2010
eye photoreceptor cell development process quality, abnormal Fig. 5 from Ebermann et al., 2010
inner ear receptor cell development process quality, abnormal Fig. 5 from Ebermann et al., 2010

Phenotype of all Fish created by or utilizing MO1-pdzd7a
Phenotype Fish Conditions Figures
eye photoreceptor cell development process quality, abnormal AB + MO1-pdzd7a standard conditions Fig. 5 from Ebermann et al., 2010
eye photoreceptor cell apoptotic, abnormal AB + MO1-pdzd7a standard conditions Fig. 5 from Ebermann et al., 2010
inner ear receptor cell development process quality, abnormal AB + MO1-pdzd7a standard conditions Fig. 5 from Ebermann et al., 2010
anterior crista stereocilium bundle malformed, abnormal AB + MO1-pdzd7a standard conditions Fig. 5 from Ebermann et al., 2010
eye photoreceptor cell photoreceptor connecting cilium physical object quality, abnormal AB + MO1-pdzd7a standard conditions Fig. 5 from Ebermann et al., 2010
eye photoreceptor cell apoptotic, abnormal AB + MO1-adgrv1 + MO1-pdzd7a standard conditions Fig. 5 from Ebermann et al., 2010
eye photoreceptor cell apoptotic, abnormal AB + MO1-pdzd7a + MO1-ush2a standard conditions Fig. 5 from Ebermann et al., 2010
OTHER MO1-pdzd7a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)