ZFIN ID: ZDB-MRPHLNO-100617-5
Morpholino Name: MO1-adgrv1
Target: adgrv1 (1)
Sequence:
5' - AAGTTGATCCTGTTACCTCAGATAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-adgrv1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-adgrv1 No data available
PHENOTYPE 
Phenotype resulting from MO1-adgrv1
No data available

Phenotype of all Fish created by or utilizing MO1-adgrv1
Phenotype Fish Conditions Figures
eye photoreceptor cell apoptotic, abnormal AB + MO1-adgrv1 + MO1-pdzd7a standard conditions Fig. 5 from Ebermann et al., 2010
OTHER MO1-adgrv1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)