header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100614-4
Morpholino Name: MO1-rest
Target: rest (1)
Sequence:
5' - GGCCTTTCACCTGTAAAATACAGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rest No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rest
Expressed Gene Anatomy Figures
dbx1a Fig. 2 with image from Gates et al., 2010
epha4a Fig. 5 with image from Mapp et al., 2011
foxa2 Fig. 2 with image from Gates et al., 2010
gli1 Fig. 6 with image from Gates et al., 2010
gli2a Fig. 6 with imageFig. S6 with image from Gates et al., 2010
gli3 Fig. 6 with image from Gates et al., 2010
nkx2.2a Fig. 2 with imageFig. 4 with imageFig. 5 with imageFig. 7 with imageFig. 8 with imageFig. S3 with imageFig. S6 with image from Gates et al., 2010
pax3a Fig. 2 with imageFig. 4 with image from Gates et al., 2010
ptch2 Fig. 2 with imageFig. 7 with image from Gates et al., 2010
rest Fig. S6 with image from Mapp et al., 2011
PHENOTYPE
Phenotype resulting from MO1-rest
Phenotype of all Fish created by or utilizing MO1-rest
Phenotype Fish Conditions Figures
neural tube wholly ventralized, abnormal WT + MO1-rest standard conditions Fig. 2 with image from Gates et al., 2010
regulation of smoothened signaling pathway disrupted, abnormal WT + MO1-rest standard conditions Fig. 2 with image from Gates et al., 2010
smoothened signaling pathway involved in dorsal/ventral neural tube patterning disrupted, abnormal WT + MO1-rest standard conditions Fig. 2 with image from Gates et al., 2010
embryo development decreased rate, abnormal WT + MO1-rest standard conditions text only from Gates et al., 2010
whole organism decreased size, abnormal WT + MO1-rest standard conditions text only from Gates et al., 2010
dorsal/ventral neural tube patterning disrupted, abnormal WT + MO1-rest standard conditions Fig. 2 with image from Gates et al., 2010
neuron migration process quality, abnormal rw0Tg + MO1-rest standard conditions Fig. 5 with image from Mapp et al., 2011
facial nerve motor nucleus mislocalised anteriorly, abnormal rw0Tg + MO1-rest standard conditions Fig. 5 with image from Mapp et al., 2011
facial nerve motor nucleus motor neuron migration decreased occurrence, abnormal rw0Tg + MO1-rest + MO5-rest control Fig. 1 with image from Love et al., 2015
rhombomere 6 has fewer parts of type facial nerve motor nucleus motor neuron, abnormal rw0Tg + MO1-rest + MO5-rest control Fig. 1 with image from Love et al., 2015
facial nerve motor nucleus motor neuron displaced to rhombomere 4, abnormal rw0Tg + MO1-rest + MO5-rest control Fig. 1 with image from Love et al., 2015
facial nerve motor nucleus motor neuron displaced to rhombomere 5, abnormal rw0Tg + MO1-rest + MO5-rest control Fig. 1 with image from Love et al., 2015
OTHER MO1-rest MORPHOLINO PAGESNo links to external sites
CITATIONS (5)