Morpholino

MO2-dok7

ID
ZDB-MRPHLNO-100602-6
Name
MO2-dok7
Previous Names
  • zDok-7 exon 2 splice MO2 (1)
Target
Sequence
5' - ATTTATAGGATTTACCTGCTACCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dok7
Phenotype
Phenotype resulting from MO2-dok7
Phenotype of all Fish created by or utilizing MO2-dok7
Phenotype Fish Conditions Figures
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal WT + MO2-dok7 standard conditions Fig. 4 from Müller et al., 2010
myotome malformed, abnormal WT + MO2-dok7 standard conditions Fig. 5 from Müller et al., 2010
myotome slow muscle cell misaligned with myotome slow muscle cell, abnormal WT + MO2-dok7 standard conditions Fig. 5 from Müller et al., 2010
locomotion decreased occurrence, abnormal WT + MO2-dok7 standard conditions Fig. 4Fig. 5 from Müller et al., 2010
post-vent region decreased length, abnormal WT + MO2-dok7 standard conditions Fig. 3 from Müller et al., 2010
slow muscle cell curved, abnormal WT + MO2-dok7 standard conditions Fig. 5 from Müller et al., 2010
myotome neuromuscular junction decreased size, abnormal WT + MO2-dok7 standard conditions Fig. 4 from Müller et al., 2010
neuromuscular junction development decreased occurrence, abnormal WT + MO2-dok7 standard conditions Fig. 4 from Müller et al., 2010
myotome neuromuscular junction decreased amount, abnormal WT + MO2-dok7 standard conditions Fig. 4 from Müller et al., 2010
horizontal myoseptum neuromuscular junction morphology, ameliorated slc24a5b1/+ + MO2-dok7 chemical treatment by environment: albuterol Fig. 2 with image from McMacken et al., 2018
whole organism decreased mobility, abnormal slc24a5b1/+ + MO2-dok7 standard conditions Fig. 1 from McMacken et al., 2018
thigmotaxis process quality, ameliorated slc24a5b1/+ + MO2-dok7 chemical treatment by environment: albuterol Fig. 1 from McMacken et al., 2018
thigmotaxis disrupted, abnormal slc24a5b1/+ + MO2-dok7 standard conditions Fig. 1 from McMacken et al., 2018
myotome cholinergic synapse decreased amount, abnormal slc24a5b1/+ + MO2-dok7 standard conditions Fig. 2 with image from McMacken et al., 2018
myotome cholinergic synapse amount, ameliorated slc24a5b1/+ + MO2-dok7 chemical treatment by environment: albuterol Fig. 2 with image from McMacken et al., 2018
whole organism mobility, ameliorated slc24a5b1/+ + MO2-dok7 chemical treatment by environment: albuterol Fig. 1 from McMacken et al., 2018
horizontal myoseptum neuromuscular junction morphology, abnormal slc24a5b1/+ + MO2-dok7 standard conditions Fig. 2 with image from McMacken et al., 2018
Citations