header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100524-5
Morpholino Name: MO1-prkar1aa
Target: prkar1aa (1)
Sequence:
5' - CACTGCTCGTACTGCTGGACGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-prkar1aa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-prkar1aa
Expressed Gene Anatomy Figures
prkar1aa Fig. 4 from Kotani et al., 2010
prrc1 Fig. 4 from Kotani et al., 2010
PHENOTYPE
Phenotype resulting from MO1-prkar1aa
Phenotype of all Fish created by or utilizing MO1-prkar1aa
OTHER MO1-prkar1aa MORPHOLINO PAGESNo links to external sites
CITATIONS (1)