header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100423-9
Morpholino Name: MO1-pou3f2b
Target: pou3f2b (1)
Previous Names: MO1-pou3f2, pou47 (ATG) (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATGATTGGATGCTGTAGTCGCCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation-blocker
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pou3f2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pou3f2b
Expressed Gene Anatomy Figures
fli1a Fig. 4 with image from Wong et al., 2017
kdr Fig. 4 with image from Wong et al., 2017
PHENOTYPE
Phenotype resulting from MO1-pou3f2b
Phenotype of all Fish created by or utilizing MO1-pou3f2b
OTHER MO1-pou3f2b MORPHOLINO PAGESNo links to external sites
CITATIONS (2)