ZFIN ID: ZDB-MRPHLNO-100423-3
Morpholino Name: MO3-rx2
Target: rx2 (1)
Previous Name: rx2 ATG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCATGGTATCTGGTGACAGATGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-rx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-rx2 No data available
PHENOTYPE
Phenotype resulting from MO3-rx2
No data available

Phenotype of all Fish created by or utilizing MO3-rx2
Genome Resources:
CITATIONS (1)