header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-091028-1
Morpholino Name: MO1-dio2
Target: dio2 (1)
Sequence:
5' - TCCACACTAAGCAAGCCCATTTCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dio2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dio2
Expressed Gene Anatomy Figures
thraa Fig. 9Fig. 10 from Walpita et al., 2009
thrb Fig. 9 from Walpita et al., 2009
tyr Fig. 9Fig. 10 from Walpita et al., 2009
PHENOTYPE
Phenotype resulting from MO1-dio2
Phenotype of all Fish created by or utilizing MO1-dio2
Phenotype Fish Conditions Figures
inner ear hypoplastic, abnormal WIK + MO1-dio2 standard conditions Fig. 2 from Walpita et al., 2010
developmental pigmentation delayed, abnormal WIK + MO1-dio2 standard conditions Fig. 3Fig. 4 from Walpita et al., 2009
whole organism decreased pigmentation, abnormal WIK + MO1-dio2 standard conditions Fig. 2 from Walpita et al., 2010
whole organism hypoplastic, abnormal WIK + MO1-dio2 standard conditions Fig. 1 from Walpita et al., 2010
head orientation trunk, abnormal WIK + MO1-dio2 standard conditions Fig. 2 from Walpita et al., 2010
embryonic morphogenesis paedomorphic growth, abnormal WIK + MO1-dio2 standard conditions Fig. 1 from Walpita et al., 2010
embryo development delayed, abnormal WIK + MO1-dio2 standard conditions Fig. 3Fig. 4 from Walpita et al., 2009
developmental pigmentation disrupted, abnormal WIK + MO1-dio2 standard conditions Fig. 2 from Walpita et al., 2010
eye decreased area, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 4 with image from Houbrechts et al., 2016
retinal ganglion cell layer increased thickness, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 5 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal cone cell, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 6 with image from Houbrechts et al., 2016
whole organism decreased length, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 4 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer green sensitive photoreceptor cell, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 6 with image from Houbrechts et al., 2016
response to light stimulus decreased occurrence, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 8 with image from Houbrechts et al., 2016
post-vent region truncated, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 1 from Walpita et al., 2010
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer UV sensitive photoreceptor cell, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 6 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer red sensitive photoreceptor cell, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 6 with image from Houbrechts et al., 2016
developmental pigmentation disrupted, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 2 from Walpita et al., 2010
inner ear aplastic, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 1Fig. 2Fig. 3 from Walpita et al., 2010
retinal ganglion cell layer retinal ganglion cell sparse, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 5 with image from Houbrechts et al., 2016
whole organism decreased pigmentation, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 2Fig. 3 from Walpita et al., 2010
whole organism morphology, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 1 from Walpita et al., 2010
embryonic morphogenesis paedomorphic growth, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 1 from Walpita et al., 2010
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer blue sensitive photoreceptor cell, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 6 with image from Houbrechts et al., 2016
retina layer formation decreased process quality, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 5 with image from Houbrechts et al., 2016
head orientation trunk, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 2Fig. 3 from Walpita et al., 2010
whole organism curved ventral, abnormal WIK + MO1-dio1 + MO1-dio2 standard conditions Fig. 1 from Walpita et al., 2010
swim bladder development disrupted, abnormal WT + MO1-dio1 + MO1-dio2 standard conditions Fig. 4 from Heijlen et al., 2013
whole organism dead, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-dio2 bacterial treatment by injection: Streptococcus pneumoniae Fig. 1 from van der Spek et al., 2018
whole organism life span, ameliorated mitfaw2/w2; mpv17a9/a9 + MO1-dio2 bacterial treatment by injection: Streptococcus pneumoniae, chemical treatment by environment: 3,3',5-triiodo-L-thyronine Fig. 1 from van der Spek et al., 2018
whole organism decreased life span, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-dio2 bacterial treatment by injection: Streptococcus pneumoniae Fig. 1 from van der Spek et al., 2018
OTHER MO1-dio2 MORPHOLINO PAGESNo links to external sites
CITATIONS (7)