ZFIN ID: ZDB-MRPHLNO-090924-3
Morpholino Name: MO1-ddx4
Target: ddx4 (1)
Sequence:
5' - ACTCTGATCTTCCTCCCAGTCATCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ddx4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ddx4
Expressed Gene Anatomy Figures
ddx4 Fig. 1 from Braat et al., 2001
PHENOTYPE
Phenotype resulting from MO1-ddx4
No data available

Phenotype of all Fish created by or utilizing MO1-ddx4
No data available
Genome Resources:
CITATIONS (2)