header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090918-2
Morpholino Name: MO2-lnx2b
Target: lnx2b (1)
Previous Name: lnx-l ATG MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGACTCCGTCATGGCCTGGAGAAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-lnx2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-lnx2b
Expressed Gene Anatomy Figures
hoxb1b Fig. 1 from Ro et al., 2009
otx2b Fig. 1 from Ro et al., 2009
PHENOTYPE
Phenotype resulting from MO2-lnx2b
Phenotype of all Fish created by or utilizing MO2-lnx2b
Genome Resources:
CITATIONS (1)