ZFIN ID: ZDB-MRPHLNO-090820-4
Morpholino Name: MO1-eaf1
Target: eaf1 (1)
Previous Name: Eaf1-MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCGGCGGGTTCGAGCTGCCGTTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-eaf1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-eaf1
Expressed Gene Anatomy Figures
cdx4 Fig. S3 with image from Liu et al., 2013
cmlc1 Fig. 6 from Liu et al., 2009
ctslb Fig. 2 from Liu et al., 2009
dlx3b Fig. 2 from Liu et al., 2009
foxa3 Fig. S1 from Liu et al., 2017
foxi1 Fig. S1 from Liu et al., 2017
foxo3b Fig. 7 from Liu et al., 2009
gata2a Fig. S1 from Liu et al., 2017
gata5 Fig. S1 from Liu et al., 2017
Fig. 6 from Liu et al., 2009
myod1 Fig. 3 from Liu et al., 2009
ndr1 Fig. S3 with image from Liu et al., 2013
otx1 Fig. 3 from Liu et al., 2009
six3b Fig. 1 with image from Liu et al., 2013
tbx6 Fig. S3 with image from Liu et al., 2013
tbxta Fig. 2Fig. 3 from Liu et al., 2009
wnt4 Fig. 4 with image from Wan et al., 2010
zic1 Fig. 2 with image from Liu et al., 2013
PHENOTYPE
Phenotype resulting from MO1-eaf1
Phenotype of all Fish created by or utilizing MO1-eaf1
Phenotype Fish Conditions Figures
presumptive endoderm foxa3 expression increased amount, abnormal AB + MO1-eaf1 standard conditions Fig. S1 from Liu et al., 2017
transforming growth factor beta receptor signaling pathway decreased process quality, abnormal AB + MO1-eaf1 standard conditions Fig. 7 from Liu et al., 2017
muscle cell migration disrupted, abnormal AB + MO1-eaf1 standard conditions Fig. 6 from Liu et al., 2009
heart development disrupted, abnormal AB + MO1-eaf1 standard conditions Fig. 6 from Liu et al., 2009
neural plate increased width, abnormal AB + MO1-eaf1 standard conditions Fig. 3 from Liu et al., 2009
whole organism decreased length, abnormal AB + MO1-eaf1 standard conditions Fig. 2 from Liu et al., 2009
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB + MO1-eaf1 standard conditions Fig. S1 from Liu et al., 2017
head decreased size, abnormal AB + MO1-eaf1 standard conditions Fig. 2 from Liu et al., 2009
convergent extension involved in axis elongation disrupted, abnormal AB + MO1-eaf1 standard conditions Fig. 2Fig. 3 from Liu et al., 2009
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-eaf1 standard conditions Fig. 6 from Liu et al., 2009
post-vent region decreased length, abnormal AB + MO1-eaf1 standard conditions Fig. 2 from Liu et al., 2009
presumptive ectoderm foxi1 expression decreased amount, abnormal AB + MO1-eaf1 standard conditions Fig. S1 from Liu et al., 2017
adaxial cell position, abnormal AB + MO1-eaf1 standard conditions Fig. 3 from Liu et al., 2009
presumptive ectoderm gata2a expression decreased amount, abnormal AB + MO1-eaf1 standard conditions Fig. S1 from Liu et al., 2017
presumptive endoderm gata5 expression increased amount, abnormal AB + MO1-eaf1 standard conditions Fig. S1 from Liu et al., 2017
axial chorda mesoderm decreased length, abnormal AB + MO1-eaf1 standard conditions Fig. 3 from Liu et al., 2009
neuroectoderm anterior region decreased size, abnormal WT + MO1-eaf1 standard conditions Fig. 1 with imageFig. 2 with image from Liu et al., 2013
neuroectoderm anterior region increased size, abnormal w32Tg + MO1-eaf1 heat shock Fig. 2 with image from Liu et al., 2013
convergent extension involved in axis elongation disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2Fig. 3Fig. 4Fig. 9 from Liu et al., 2009
presumptive endoderm gata5 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 1Fig. 6 from Liu et al., 2017
neural plate increased width, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
whole organism decreased length, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2Fig. 9 from Liu et al., 2009
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 4 from Liu et al., 2009
endoderm sox32 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2017
presumptive mesoderm tbxta expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 1Fig. 6 from Liu et al., 2017
adaxial cell position, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
prechordal plate mislocalised posteriorly, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
pancreas development disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2009
presumptive endoderm mixl1 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 1 from Liu et al., 2017
whole organism morphology, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2017
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 1 from Liu et al., 2017
muscle cell migration disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2009
eye fused with eye, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2Fig. 9 from Liu et al., 2009
heart development disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6Fig. 9 from Liu et al., 2009
mesoderm lft1 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2017
whole organism tp53 expression decreased amount, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2017
post-vent region decreased length, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2009
presumptive mesoderm lft1 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2017
presumptive mesoderm increased width, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 5 from Liu et al., 2009
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6Fig. 9 from Liu et al., 2009
head decreased size, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2Fig. 9 from Liu et al., 2009
presumptive endoderm sox32 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 1 from Liu et al., 2017
presumptive endoderm increased size, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 5 from Liu et al., 2009
segmental plate decreased length, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
axial chorda mesoderm decreased length, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
presumptive mesoderm tbxta expression amount, ameliorated AB + MO1-eaf1 + MO1-eaf2 + MO4-tp53 standard conditions Fig. 6 from Liu et al., 2017
presumptive endoderm gata5 expression amount, ameliorated tdgf1tz257/tz257 + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2017
presumptive endoderm sox32 expression amount, ameliorated tdgf1tz257/tz257 + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2017
presumptive endoderm gata5 expression amount, ameliorated tp53zdf1/zdf1 + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2017
whole organism morphology, ameliorated tp53zdf1/zdf1 + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2017
Genome Resources:
CITATIONS (6)