ZFIN ID: ZDB-MRPHLNO-090520-6
Morpholino Name: MO3-foxi1
Target: foxi1 (1)
Sequence:
5' - ATCCGCTCTCCCTCCAGAAACATGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-foxi1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-foxi1
Expressed Gene Anatomy Figures
atp1a1a.2 Fig. 3 with image from Esaki et al., 2009
atp6v1ab Fig. 3 with image from Esaki et al., 2009
dlc Fig. 3 with image from Esaki et al., 2009
foxi3a Fig. 3 with image from Esaki et al., 2009
foxi3b Fig. 8 with image from Esaki et al., 2009
notch1a Fig. 3 with image from Esaki et al., 2009
tp63 Fig. 4 with image from Esaki et al., 2009
PHENOTYPE
Phenotype resulting from MO3-foxi1
Phenotype Figures
epithelial cell differentiation process quality, abnormal Fig. 3 with image from Esaki et al., 2009
integument physical object quality, abnormal Fig. 3 with image from Esaki et al., 2009

Phenotype of all Fish created by or utilizing MO3-foxi1
Phenotype Fish Conditions Figures
epithelial cell differentiation process quality, abnormal WT + MO3-foxi1 standard conditions Fig. 3 with image from Esaki et al., 2009
integument physical object quality, abnormal WT + MO3-foxi1 standard conditions Fig. 3 with image from Esaki et al., 2009
OTHER MO3-foxi1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)