ZFIN ID: ZDB-MRPHLNO-090423-1
Morpholino Name: MO2-spns2
Target: spns2 (1)
Sequence:
5' - GGAGGGAATATGTGATGCTTACTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-spns2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-spns2 No data available
PHENOTYPE
Phenotype resulting from MO2-spns2
Phenotype of all Fish created by or utilizing MO2-spns2
Genome Resources:
CITATIONS (5)