Morpholino

MO1-ap1s1

ID

ZDB-MRPHLNO-090323-1

Name

MO1-ap1s1

Previous Names

None

Target

ap1s1 (1)

Sequence

5' - ACAGAAGCATAAAGCGCATCATTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ap1s1

No data available

Phenotype

Phenotype resulting from MO1-ap1s1

Phenotype	Fish	Figures
axon extension disrupted, abnormal	WT + MO1-ap1s1	Fig. 4 from Montpetit et al., 2008
caudal fin disorganized, abnormal	WT + MO1-ap1s1	Fig. 2 from Montpetit et al., 2008
caudal fin basement membrane disorganized, abnormal	WT + MO1-ap1s1	Fig. 3 from Montpetit et al., 2008
caudal fin basement membrane distributed, abnormal	WT + MO1-ap1s1	Fig. 3 from Montpetit et al., 2008
integument disorganized, abnormal	WT + MO1-ap1s1	Fig. 2 from Montpetit et al., 2008
larval locomotory behavior disrupted, abnormal	WT + MO1-ap1s1	Fig. 4 from Montpetit et al., 2008
pigmentation decreased occurrence, abnormal	WT + MO1-ap1s1	Fig. 2 from Montpetit et al., 2008
sensory perception of touch disrupted, abnormal	WT + MO1-ap1s1	Fig. 4 from Montpetit et al., 2008
spinal cord interneuron decreased amount, abnormal	WT + MO1-ap1s1	Fig. 4 from Montpetit et al., 2008
whole organism decreased size, abnormal	WT + MO1-ap1s1	Fig. 2 from Montpetit et al., 2008

Phenotype of all Fish created by or utilizing MO1-ap1s1

Phenotype	Fish	Conditions	Figures
caudal fin disorganized, abnormal	WT + MO1-ap1s1	standard conditions	Fig. 2 from Montpetit et al., 2008
sensory perception of touch disrupted, abnormal	WT + MO1-ap1s1	standard conditions	Fig. 4 from Montpetit et al., 2008
caudal fin basement membrane disorganized, abnormal	WT + MO1-ap1s1	standard conditions	Fig. 3 from Montpetit et al., 2008
pigmentation decreased occurrence, abnormal	WT + MO1-ap1s1	standard conditions	Fig. 2 from Montpetit et al., 2008
integument disorganized, abnormal	WT + MO1-ap1s1	standard conditions	Fig. 2 from Montpetit et al., 2008
hindbrain distended, abnormal	WT + MO1-ap1s1	chemical treatment: neocuproine	Fig. 5 from Ishizaki et al., 2010
larval locomotory behavior disrupted, abnormal	WT + MO1-ap1s1	standard conditions	Fig. 4 from Montpetit et al., 2008
whole organism decreased size, abnormal	WT + MO1-ap1s1	standard conditions	Fig. 2 from Montpetit et al., 2008
notochord kinked, abnormal	WT + MO1-ap1s1	chemical treatment: neocuproine	Fig. 5 from Ishizaki et al., 2010
spinal cord interneuron decreased amount, abnormal	WT + MO1-ap1s1	standard conditions	Fig. 4 from Montpetit et al., 2008
melanocyte decreased pigmentation, abnormal	WT + MO1-ap1s1	chemical treatment: neocuproine	Fig. 5 from Ishizaki et al., 2010
axon extension disrupted, abnormal	WT + MO1-ap1s1	standard conditions	Fig. 4 from Montpetit et al., 2008
caudal fin basement membrane distributed, abnormal	WT + MO1-ap1s1	standard conditions	Fig. 3 from Montpetit et al., 2008
melanocyte decreased pigmentation, abnormal	WT + MO1-ap1s1	chemical treatment: neocuproine	Fig. 5 from Ishizaki et al., 2010

Citations