header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090106-1
Morpholino Name: MO1-cdk5
Target: cdk5 (1)
Previous Name: cdk5-SMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGTGGCGTCTCTGACCTCAGCAGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splicing modification. Morpholino targets the exon3–intron3 boundary and results in a shorter mRNA.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cdk5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cdk5 No data available
PHENOTYPE
Phenotype resulting from MO1-cdk5
Phenotype of all Fish created by or utilizing MO1-cdk5
Phenotype Fish Conditions Figures
retinal ganglion cell layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
retina layer formation disrupted, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
retinal inner nuclear layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
retinal outer plexiform layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
eye decreased size, abnormal AB + MO1-cdk5 standard conditions Fig. 3Fig. S2 from Leung et al., 2008
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-cdk5 standard conditions Fig. 3Fig. S2 from Leung et al., 2008
retina morphology, abnormal AB + MO1-cdk5 standard conditions Fig. S2 from Leung et al., 2008
whole organism decreased size, abnormal AB + MO1-cdk5 standard conditions Fig. S2 from Leung et al., 2008
retinal outer nuclear layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
cranial nerve II aplastic, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-cdk5 standard conditions Fig. 3 with image from Tanaka et al., 2012
CaP motoneuron mislocalised, abnormal RW + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 3 from Morimura et al., 2013
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 3 with imageFig. 9 with image from Tanaka et al., 2012
neural crest cell displaced to spinal cord lateral margin, abnormal WT + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 10 with image from Tanaka et al., 2012
Rohon-Beard neuron displaced to spinal cord axis, abnormal rw011bTg + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 7 with image from Tanaka et al., 2012
OTHER MO1-cdk5 MORPHOLINO PAGES No links to external sites
CITATIONS (3)