ZFIN ID: ZDB-MRPHLNO-081110-3
Morpholino Name: MO3-lclat1
Target: lclat1 (1)
Previous Names: lycat-MO3 (1), MO3-lycat (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTGAACACACACACTGACCGAAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-lclat1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-lclat1
Expressed Gene Anatomy Figures
etsrp Fig. 3Fig. S3 from Xiong et al., 2008
etv6 Fig. 1 from Rasighaemi et al., 2015
fli1 Fig. 3 from Xiong et al., 2008
gata1a Fig. 4 from Xiong et al., 2008
kdrl Fig. 3 from Xiong et al., 2008
lmo2 Fig. 4 from Xiong et al., 2008
tal1 Fig. 1 from Rasighaemi et al., 2015
Fig. 4 from Xiong et al., 2008
tie1 Fig. S3 from Xiong et al., 2008
PHENOTYPE
Phenotype resulting from MO3-lclat1
Phenotype of all Fish created by or utilizing MO3-lclat1
Phenotype Fish Conditions Figures
blood cell decreased amount, abnormal WT + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
blood vessel development disrupted, abnormal WT + MO3-lclat1 standard conditions Fig. 1Fig. S3 from Xiong et al., 2008
intermediate cell mass of mesoderm etv6 expression decreased amount, abnormal WT + MO3-lclat1 standard conditions Fig. 1 from Rasighaemi et al., 2015
blood vasculature decreased amount, abnormal WT + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
endocardium aplastic, abnormal WT + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
intermediate cell mass of mesoderm tal1 expression decreased amount, abnormal WT + MO3-lclat1 standard conditions Fig. 1 from Rasighaemi et al., 2015
blood vessel development disrupted, abnormal la781Tg + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
blood vasculature decreased amount, abnormal la781Tg + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
endothelial cell decreased amount, abnormal zf528Tg + MO3-lclat1 standard conditions Fig. S2 from Xiong et al., 2008
blood vessel development disrupted, abnormal zf528Tg + MO3-lclat1 standard conditions Fig. 1Fig. S2 from Xiong et al., 2008
endocardium aplastic, abnormal zf528Tg + MO3-lclat1 standard conditions Fig. S2 from Xiong et al., 2008
endothelial cell development disrupted, abnormal zf528Tg + MO3-lclat1 standard conditions Fig. S2 from Xiong et al., 2008
blood vasculature decreased amount, abnormal zf528Tg + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
Genome Resources:
CITATIONS (3)