header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081105-1
Morpholino Name: MO2-sparc
Target: sparc (1)
Previous Name: ATG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GATCCAAACCCTCATCTTGAGTTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sparc No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sparc
Expressed Gene Anatomy Figures
gata1a Fig. 6 from Ceinos et al., 2013
PHENOTYPE
Phenotype resulting from MO2-sparc
Phenotype of all Fish created by or utilizing MO2-sparc
OTHER MO2-sparc MORPHOLINO PAGES No links to external sites
CITATIONS (2)