ZFIN ID: ZDB-MRPHLNO-081105-1
Morpholino Name: MO2-sparc
Target: sparc (1)
Previous Name: ATG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GATCCAAACCCTCATCTTGAGTTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sparc No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sparc
Expressed Gene Anatomy Figures
gata1a intermediate cell mass of mesoderm Fig. 6 from Ceinos et al., 2013
PHENOTYPE 
Phenotype resulting from MO2-sparc
Phenotype Figures
ceratobranchial cartilage aplastic, abnormal text only from Rotllant et al., 2008
ceratohyal cartilage decreased size, abnormal text only from Rotllant et al., 2008
chondrocranium cartilage decreased size, abnormal text only from Rotllant et al., 2008
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal Fig. 6 from Ceinos et al., 2013
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal Fig. 6 from Ceinos et al., 2013
Meckel's cartilage decreased size, abnormal text only from Rotllant et al., 2008
pectoral fin decreased size, abnormal text only from Rotllant et al., 2008
pectoral fin kinked, abnormal text only from Rotllant et al., 2008
ventral mandibular arch decreased size, abnormal text only from Rotllant et al., 2008
vestibuloauditory system functionality, abnormal text only from Rotllant et al., 2008
whole organism decreased length, abnormal text only from Rotllant et al., 2008
whole organism lethal (sensu genetics), abnormal text only from Rotllant et al., 2008

Phenotype of all Fish created by or utilizing MO2-sparc
Phenotype Fish Conditions Figures
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO2-sparc control Fig. 6 from Ceinos et al., 2013
chondrocranium cartilage decreased size, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
vestibuloauditory system functionality, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
pectoral fin kinked, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
whole organism lethal (sensu genetics), abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
Meckel's cartilage decreased size, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
whole organism decreased length, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
pectoral fin decreased size, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
ceratobranchial cartilage aplastic, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
ceratohyal cartilage decreased size, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
ventral mandibular arch decreased size, abnormal AB + MO2-sparc standard conditions text only from Rotllant et al., 2008
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO2-sparc + MO4-tp53 control Fig. 6 from Ceinos et al., 2013
OTHER MO2-sparc MORPHOLINO PAGESNo links to external sites
CITATIONS (2)