Morpholino

MO1-mapk1

ID

ZDB-MRPHLNO-081020-6

Name

MO1-mapk1

Previous Names

ERK2-MO (1)

Target

mapk1 (1)

Sequence

5' - CACCCAAAAGCACCAGGAAAAGCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-mapk1

Expressed Gene	Anatomy	Figures
cdh2	whole organism	Fig. 4 from Krens et al., 2008
chrd	shield	Fig. S3 from Krens et al., 2008
ctslb	polster	Fig. 2 from Krens et al., 2008
dlx3b	neural plate	Fig. 2 from Krens et al., 2008
etv5b	whole organism	Fig. 4 from Krens et al., 2008
fosab	whole organism	Fig. 4 from Krens et al., 2008
gata2a	non neural ectoderm	Fig. S3 from Krens et al., 2008
gsc	shield (not) whole organism	Fig. 10 from Krens et al., 2008 Fig. S3 from Krens et al., 2008
lft1	embryonic structure	Fig. 10 from Krens et al., 2008
mapk1	whole organism	Fig. 1 from Krens et al., 2008
mapk3	whole organism	Fig. 1 from Krens et al., 2008
mos	whole organism	Fig. 4 from Krens et al., 2008
myb	dorsal aorta	Fig. 3 from Wang et al., 2013
mycn	whole organism	Fig. 4 from Krens et al., 2008
ndr2	axial mesoderm	Fig. S3 from Krens et al., 2008
otx2b	ectoderm	Fig. S3 from Krens et al., 2008
runx1	dorsal aorta	Fig. 3 from Wang et al., 2013
shha	axis	Fig. 2 from Krens et al., 2008
snai1a	presumptive paraxial mesoderm whole organism	Fig. 4 from Krens et al., 2008 Fig. S3 from Krens et al., 2008
sox17	endoderm forerunner cell group	Fig. S3 from Krens et al., 2008
tbx16l	margin presumptive mesoderm	Fig. 10 from Krens et al., 2008 Fig. 6 from Krens et al., 2008
tbxta	axial mesoderm embryonic structure margin presumptive mesoderm	Fig. 10 from Krens et al., 2008 Fig. 6 , Fig. S3 from Krens et al., 2008
vegfaa	whole organism	Fig. 4 from Krens et al., 2008
vent	embryonic structure	Fig. 10 from Krens et al., 2008
vox	embryonic structure	Fig. 10 from Krens et al., 2008

Phenotype

Phenotype resulting from MO1-mapk1

Phenotype	Fish	Figures
convergent extension involved in gastrulation disrupted, abnormal	WT + MO1-mapk1	Fig. 3 from Krens et al., 2008
gastrulation disrupted, abnormal	WT + MO1-mapk1	Fig. 1 from Krens et al., 2008
notochord increased width, abnormal	WT + MO1-mapk1	Fig. 2 from Krens et al., 2008
pericardial cavity edematous, abnormal	WT + MO1-mapk1	Fig. 1 from Krens et al., 2008
whole organism decreased length, abnormal	WT + MO1-mapk1	Fig. 1 , Fig. 2 from Krens et al., 2008
whole organism deformed, abnormal	WT + MO1-mapk1	Fig. 1 from Krens et al., 2008

Phenotype of all Fish created by or utilizing MO1-mapk1

Phenotype	Fish	Conditions	Figures
convergent extension involved in gastrulation disrupted, abnormal	WT + MO1-mapk1	standard conditions	Fig. 3 from Krens et al., 2008
gastrulation disrupted, abnormal	WT + MO1-mapk1	standard conditions	Fig. 1 from Krens et al., 2008
pericardial cavity edematous, abnormal	WT + MO1-mapk1	standard conditions	Fig. 1 from Krens et al., 2008
whole organism decreased length, abnormal	WT + MO1-mapk1	standard conditions	Fig. 1 , Fig. 2 from Krens et al., 2008
whole organism deformed, abnormal	WT + MO1-mapk1	standard conditions	Fig. 1 from Krens et al., 2008
notochord increased width, abnormal	WT + MO1-mapk1	standard conditions	Fig. 2 from Krens et al., 2008

Citations